protocol_455.txt

Generating viral metagenomes from the coral holobiont
At Trunk Reef, approximately 45 g of coral tissue was sampled from three healthy, freshly collected coral colonies of Pocillopora damicornis.
Approximately 20 g of Acropora tenuis tissue was sampled from three healthy, freshly collected coral colonies collected in Pioneer Bay.
Fragments were washed in autoclaved, 0.02 μm filtered virus-free seawater.
Subsequently, tissue was blasted from the coral skeleton, using an air-gun, into 15 mL 0.02 μm filtered (Anotop, Whatman) SM buffer (100 mM NaCl, 8 mM MgSO4, 50 mM Tris pH 7.5) in a zip-lock bag.
Briefly, 5 mL of chloroform per 40 mL of coral blastate was added and samples were agitated gently for 1 h at room temperature.
Coral blastates were homogenized at 5000 rpm for 1 min (Heidolph SilentCrusher™).
Samples were immediately centrifuged at 1000 g for 15 min.
The supernatant was transferred to sterile glass corex tubes and spun at 12,000 g for 15 min to pellet the majority of microbial cells (Beckman Coulter JA 25.50 rotor).
A cesium chloride (CsCl) density gradient was then formed by layering 1 mL of 1.7, 1.5, and 1.35 g mL−1 CsCl into 13.2 mL UltraClear™ ultracentrifuge tubes (Beckman Coulter) with 9 mL sample layered on the top of the gradient.
Gradients were then centrifuged for 2 h at 60,000 g at 4°C in a swinging bucket rotor.
In the MECH method, the coral tissue blastate was homogenized at 10,000 rpm for 1 min.
The coral tissue blastate was then spun at 400 g for 5 min.
The supernatant was then aliquoted into 1.5 mL aliquots in 2 mL eppendorf tubes containing 0.3 mL acid-washed glass beads (425–600 μm diameter) (Sigma-Aldrich).
The tubes were placed in a bead beater and cells were disrupted at 5000 rpm for 5 min.
Tubes were centrifuged at top speed in a bench-top Eppendorf centrifuge for 1 min.
The supernatant was collected for viral fractionation using step CsCl density gradients.
To confirm that the MECH method was not disrupting virus particles, two dsDNA viruses, OtV-2 (Weynberg et al., 2011) and EhV-86 (Wilson et al., 2005b), were subjected to the same mechanical disruption protocol.
Flow cytometry was used to enumerate viruses before and after disruption.
All samples were treated with DNase and RNase (Ambion) prior to nucleic acid extraction.
DNA was extracted and RNase treated using a MasterPure kit (Epicentre, Illumina) following manufacturer's instructions.
RNA was extracted using a Qiagen QIAamp viral RNA kit (Qiagen) following manufacturer's instructions, including the final DNase step (Ambion).
Two different amplification methods were used.
In order to reduce some of the inherent biases in multi-displacement amplification (MDA), such as a preference for ssDNA viral genomes, DNA extractions were converted to dsDNA prior to amplification.
Triplicate 10 μ L aliquots of the DNA extractions, containing ds and ssDNA viral genomes, underwent a single round of Klenow reaction (3′–5′ exo-, 5U/μ L) by mixing 1.5 μ L of 10× reaction buffer (New England Biolabs Buffer 2), 1.5 μ L of dNTPs (2.5 mM stock), 1 μ L of random hexamer primers (50 ng/μ L, Invitrogen).
The reaction was incubated at 94°C for 3 min.
The reaction was then placed on ice for 3 min to allow for primer annealing.
1 μ L of Klenow (3′–5′ exo-) was added and incubated at 25°C for 10 min.
It was then incubated at 37°C for 60 min.
It was then incubated with a termination step of 75°C for 20 min.
After termination, reactions were pooled and cleaned using a Qiagen QIAamp DNA mini kit and eluted in 50 μL of Buffer AE.
Replicate MDA reactions (n = 3 for each sample) were amplified using 2.5 μ L dsDNA template and the Qiagen RepliG® kit using the standard protocol.
All reactions were run on a 0.8% agarose gel in 1× TAE at 100 V for 30 min to confirm amplification, pooled and cleaned with QIAampl DNA minikit and eluted in 200 μ L of Buffer AE.
Negative controls were treated the same and also sent for sequencing to confirm that no viral contamination was present.
As with the RepliG® protocol, Klenow Fragment (3′–5′ exo-) was used to convert all DNA genomes to dsDNA using RP-SISPA primers with a 3′ random hexamer sequence that is used for downstream PCR amplification.
To label the first strand with the RP-SISPA primer, 5 μL of nucleic acid was added to 9 μL reaction mix containing: The reaction was incubated at 94°C for 3 min.
The reaction was then placed on ice for 3 min to allow for primer annealing.
1 μL of Klenow Fragment (3′–5′ exo-, 5U/μL, NEB #) was added and incubated at 37°C for 60 min.
A second round of Klenow Fragment reaction (3′–5′ exo) labeled the second strand with the SISPA primer, by adding an additional 1 μL of primer and 1 μL dNTP.
The reaction then underwent a 94°C for 3 min heating step.
The reaction was then put on ice for 3 min.
The reaction then underwent a final addition of 1 μL of Klenow Fragment (3′–5′ exo-).
The reaction was incubated at 37°C for 60 min.
The reaction was then terminated at 75°C for 20 min.
Briefly, in preparation for cDNA synthesis, 10 μ L purified RNA viral template was mixed with 1 μ L of 2.5 mM dNTPs and 1.3 μ L of FR26RV-N (GCCGGAGCTCTGCAGATATCNNNNNN, 10 μ M stock) and FR40RV-T primer (GCCGGAGCTCTGCAGATATC(T)20, 50 nM stock).
The reaction was heated to 65°C for 5 min.
The reaction was then cooled on ice for 3 min to allow the primers to anneal.
While still on ice, 1 μL DTT (Invitrogen) was added to the reaction as an enzyme stabilization reagent with 1 μL RNase OUT (Invitrogen) to protect the sample from RNAse activity.
The complementary DNA strand was synthesized with 200 U of Superscript III reverse transcriptase.
The reaction was incubated initially at 25°C for 10 min to allow annealing of the hexamer 3′ end of primer FR26RV-N and the poly(T)20 3′ end of primer FR40RV-T to the template while cDNA synthesis commenced.
The temperature was then increased to 50°C for 60 min.
The first strand synthesis reaction was heated immediately to 94°C for 3 min and then rapidly cooled on ice.
A complementary second strand was subsequently synthesized at 37°C for 60 min with the addition of 1 μL Klenow Fragment (3′–5′ exo-, 5U/μL).
The Klenow reaction was terminated with a final incubation at 75°C for 20 min.
PCR amplification of the SISPA primer labeled template (DNA and RNA) was done in triplicate 25 μL reactions containing: The reaction was incubated at 95°C for 10 min.
The reaction then underwent 30 cycles of denaturation at: The PCR reactions were loaded on to a 0.8% agarose gel in 1×TAE at 100 V for 30 min.
If amplification resulted in visible PCR products (typically a smear; products should be longer than 250 bp), a reconditioning PCR was performed on pooled reactions as follows.
One reconditioning PCR contained 10 μL of pooled SISPA reaction template, 10 μL 10× buffer, 16 μL dNTP (2.5 mM stock), 8 μL FR20RV primer (10 μ M stock) and 0.75 μL TaKaRa LA HS Taq.
The reaction was incubated at 95°C for 10 min.
The reaction then underwent 5 cycles of denaturation at: Reactions were cleaned and QC was assessed.
After amplification, samples were cleaned with a QIAamp® DNA Mini kit (RepliG® amplification) or a MinElute® PCR purification kit (RP-SISPA).
Samples were checked for quantification using a Quant-iT PicoGreen® kit on a NanoDrop 3300 fluorospecrometer, for quality (260:280 ratios) on a NanoDrop 2000, and were run on a 0.8% agarose gel in 1× TAE at 100 V for 30 min to confirm a size range appropriate for sequencing (~250–500 bp) was present without contamination of smaller fragments.
All metagenomes were sequenced using Nextera XT MiSeq 250 bp paired-end sequencing (Illumina) at the Ramaciotti Centre, University of New South Wales, Sydney, Australia.
Raw sequence reads were processed in CLC Genomics Workbench 5.5.
Sequences were imported as Illumina paired-end reads, adaptor sequences were trimmed, and reads were checked for quality using a PHRED score of 20 and a minimum length of 100 bp.
Paired reads were merged and a final data set containing merged reads and ORFans was checked again for QC with a minimum length of 200 bp.
To carry out the taxonomic assignment, these non-assembled read data sets were uploaded to the Metavir web server, which is dedicated to the analysis of viral metagenomes (http://metavir-meb.univ-bpclermont.fr) (Roux et al., 2011).
All virus sequences were further classified into families using the taxonomic information from the top BLAST hit.
Tetranucleotide clustering and rarefaction curves were generated using tools available through Metavir.
The five datasets generated from the P. damicornis samples were submitted to Genbank Sequence Read Archive (SRA) and are available under the accession numbers SRR1207981, SRR1207983, SRR1207980, SRR1207984, and SRR1246941 (Table 1 in guidelines).
The two datasets generated from the A. tenuis samples have also been deposited in the SRA under the accession numbers SRR1207979 and SRR1210582.