Add linear ligation as an option (#82)

* Add linear ligation as an option

README.md

@@ -73,6 +73,7 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/),
 and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html).
 
 ## [Unreleased]
+- Added option for linear ligations [#82](https://github.com/Koeng101/dnadesign/pull/82)
 - Added minimal python packaging [#81](https://github.com/Koeng101/dnadesign/pull/81)
 - Greatly simplified the Ligate function [#77](https://github.com/Koeng101/dnadesign/pull/77)
 - Updated barcoding functions to handle edge case of hanging-edge barcodes [#74](https://github.com/Koeng101/dnadesign/pull/74)

lib/clone/clone.go

@@ -285,7 +285,7 @@ func CutWithEnzyme(part Part, directional bool, enzyme Enzyme, methylated bool)
 // the first fragment WILL be used in the ligation reaction. This function
 // is a massive simplification of the original ligation code which can do more.
 // If this does not fulfill your needs, please leave an issue in git.
-func Ligate(fragments []Fragment) (string, error) {
+func Ligate(fragments []Fragment, circular bool) (string, error) {
 	if len(fragments) == 0 {
 		return "", errors.New("no fragments to ligate")
 	}
@@ -316,10 +316,13 @@ func Ligate(fragments []Fragment) (string, error) {
 	}
 
 	// attempt circularization
-	if finalFragment.ForwardOverhang != finalFragment.ReverseOverhang {
-		return "", errors.New("does not circularize")
+	if circular {
+		if finalFragment.ForwardOverhang != finalFragment.ReverseOverhang {
+			return "", errors.New("does not circularize")
+		}
+		return finalFragment.ForwardOverhang + finalFragment.Sequence, nil
 	}
-	return finalFragment.ForwardOverhang + finalFragment.Sequence, nil
+	return finalFragment.ForwardOverhang + finalFragment.Sequence + finalFragment.ReverseOverhang, nil
 }
 
 /******************************************************************************
@@ -337,7 +340,7 @@ func GoldenGate(sequences []Part, cuttingEnzyme Enzyme, methylated bool) (string
 		newFragments := CutWithEnzyme(sequence, true, cuttingEnzyme, methylated)
 		fragments = append(fragments, newFragments...)
 	}
-	return Ligate(fragments)
+	return Ligate(fragments, true)
 }
 
 // GetBaseRestrictionEnzymes return a basic slice of common enzymes used in Golden Gate Assembly. Eventually, we want to get the data for this map from ftp://ftp.neb.com/pub/rebase

lib/clone/clone_test.go

@@ -142,7 +142,7 @@ func TestCutWithEnzymeRegression(t *testing.T) {
 func TestCircularLigate(t *testing.T) {
 	fragment1 := Fragment{"AAAAAA", "GTTG", "CTAT"}
 	fragment2 := Fragment{"AAAAAA", "CAAC", "ATAG"}
-	output, err := Ligate([]Fragment{fragment1, fragment2})
+	output, err := Ligate([]Fragment{fragment1, fragment2}, true)
 	if err != nil {
 		t.Errorf("Got error on ligation: %s", err)
 	}
@@ -151,6 +151,18 @@ func TestCircularLigate(t *testing.T) {
 	}
 }
 
+func TestLinearLigate(t *testing.T) {
+	fragment1 := Fragment{"AAAAAA", "GTTG", "CTAT"}
+	fragment2 := Fragment{"AAAAAA", "ATGC", "ATAG"}
+	output, err := Ligate([]Fragment{fragment1, fragment2}, false)
+	if err != nil {
+		t.Errorf("Got error on ligation: %s", err)
+	}
+	if output != "GTTGAAAAAACTATTTTTTTGCAT" {
+		t.Errorf("Ligation with complementing overhangs should only output 1 valid rotated sequence. Got: %s", output)
+	}
+}
+
 func TestEnzymeManage_GetEnzymeByName_NotFound(t *testing.T) {
 	enzymeManager := NewEnzymeManager(GetBaseRestrictionEnzymes())
 	_, err := enzymeManager.GetEnzymeByName("EcoRFake")