Skip to content
New issue

Have a question about this project? # for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “#”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? # to your account

Barseq data causes error #29

Closed
jweile opened this issue Jul 24, 2018 · 1 comment
Closed

Barseq data causes error #29

jweile opened this issue Jul 24, 2018 · 1 comment
Labels
bug Something isn't working

Comments

@jweile
Copy link
Collaborator

jweile commented Jul 24, 2018

Starting job 215b41bb-a05e-4632-8be8-1cca5c931762 with parameters:
ssid = urn:mavedb:00000001-a-2
uniprotId = P63279
pdbs = 5F6D
mainChains = A
wt.seq = ATGTCGGGGATCGCCCTCAGCAGACTCGCCCAGGAGAGGAAAGCATGGAGGAAAGACCACCCATTTGGTTTCGTGGCTGTCCCAACAAAAAATCCCGATGGCACGATGAACCTCATGAACTGGGAGTGCGCCATTCCAGGAAAGAAAGGGACTCCGTGGGAAGGAGGCTTGTTTAAACTACGGATGCTTTTCAAAGATGATTATCCATCTTCGCCACCAAAATGTAAATTCGAACCACCATTATTTCACCCGAATGTGTACCCTTCGGGGACAGTGTGCCTGTCCATCTTAGAGGAGGACAAGGACTGGAGGCCAGCCATCACAATCAAACAGATCCTATTAGGAATACAGGAACTTCTAAATGAACCAAATATCCAAGACCCAGCTCAAGCAGAGGCCTACACGATTTACTGCCAAAACAGAGTGGAGTACGAGAAAAGGGTCCGAGCACAAGCCAAGAAGTTTGCGCCCTCATAA
seq.offset = 0
syn.med =
stop.med = 0
overrideCache = FALSE
outFormats = pdf png svg
pngRes = 80
Loading required package: methods
hash-2.2.6 provided by Decision Patterns

Translating WT sequence to Protein...
Retrieving scoreset from local cache...
Retrieving parsed variants from local cache...
Filtering for single mutant variants...
Error in if (any(sm.mut$type == "synonymous")) { :
missing value where TRUE/FALSE needed
Calls: dashboard
Execution halted

@jweile jweile added the bug Something isn't working label Jul 24, 2018
jweile added a commit that referenced this issue Jul 24, 2018
@jweile
Copy link
Collaborator Author

jweile commented Jul 24, 2018

This seems to be caused by incorrect caching of the parsed hgvs table. The export fails to save the row names, which are required for correctly resolving indices.

# for free to join this conversation on GitHub. Already have an account? # to comment
Labels
bug Something isn't working
Projects
None yet
Development

No branches or pull requests

1 participant