-
-
Notifications
You must be signed in to change notification settings - Fork 73
New issue
Have a question about this project? # for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “#”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? # to your account
PCR simulations are wrong. #279
Comments
Sequence should be |
@Koeng101 was this ever resolved? |
No. I fixed it in bioscript but not here. I'll port the fix when I get the chance. |
What's the status of this? @Koeng101 need help with it? |
Yes, this is actually pretty high priority as well, and I should have fixed it earlier (and haven't used this part of poly since I haven't fixed it yet) |
Will take a crack at this as a break from #297 /administrative stuff. |
Great! This is very important. |
Sneaky little bug...
|
Output:
Check here - https://pkg.go.dev/github.com/TimothyStiles/poly@v0.21.1/primers/pcr
TTATAGGTCTCATACTAATAATTACACCGAGATAACACATCATGG anneals to the beginning of the sequence, NOT TATATGGTCTCTTCATTTAAGAAAGCGCATTTTCCAGC. There is no reason why the beginning of the output sequence should be
TATA
@TimothyStiles This is a fairly critical bug we should figure out.
The text was updated successfully, but these errors were encountered: