Skip to content
New issue

Have a question about this project? # for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “#”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? # to your account

some indels had frequency of zero. #135

Open
zenghp365 opened this issue Aug 2, 2024 · 2 comments
Open

some indels had frequency of zero. #135

zenghp365 opened this issue Aug 2, 2024 · 2 comments

Comments

@zenghp365
Copy link

zenghp365 commented Aug 2, 2024

when I run somaticseq "--run-mutect2 --run-vardict --run-lofreq --run-scalpel --run-strelka2 --run-somaticseq --run-workflow ", I found some indels had frequency of zero. For example,

chr1 156842000 . A AAGAAAACTGATGTAAAGTAG 0.0 REJECT MDLPK=1,0,0,0,0;NUM_TOOLS=1;LC=11.5;AF=0 GT:DP4:CD4:refMQ:altMQ:refBQ:altBQ:refNM:altNM:fetSB:fetCD:uMQ:uBQ:MQ0:VAF 0/0:258,267,0,0:501,24,0,0:59.8762:.:34.4876:.:0.12:.:1.00:1.00:.:.:0:0

and this mutant was detected by Mutect2 with a normal frequency as following,

chr1 156842000 . A AAGAAAACTGATGTAAAGTAG . PASS AS_FilterStatus=SITE;AS_SB_TABLE=254,268|2,8;DP=532;ECNT=2;GERMQ=93;MBQ=20,35;MFRL=185,155;MMQ=60,60;MPOS=13;POPAF=7.30;TLOD=22.44 GT:AD:AF:DP:F1R2:F2R1:FAD:PGT:PID:PS:SB 0|1:522,10:0.029:532:138,2:132,4:376,10:0|1:156841998_T_TTTAAAATATATATATTTTTTGCACATTTCTATGTATATTTCACAATAAAA:156841998:254,268,2,8

So, I wonder if this mutation can output a normal frequency like mutect2 ?

@litaifang
Copy link
Contributor

MuTect2 does local assembly and realignment, whereas the VAF is a simple counting of the reads in the original bam file that support this variant call. So it's entirely possible that MuTect2 can detect an indel after reassembly that's not apparent in the original alignment.

@zenghp365
Copy link
Author

Thanks for your quick reply!
Yes, I understand. But it will bring a lot of trouble to our use, and it is highly recommended that this problem be resolved.

# for free to join this conversation on GitHub. Already have an account? # to comment
Labels
None yet
Projects
None yet
Development

No branches or pull requests

2 participants