From 30a576c175f8f8f22909fcedced6ee3e28c1fd53 Mon Sep 17 00:00:00 2001 From: DLBPointon Date: Wed, 20 Nov 2024 14:38:00 +0000 Subject: [PATCH 01/10] Updating all easy to update modules --- conf/base.config | 4 +- conf/modules.config | 2 +- modules.json | 198 ++++++++++++------ .../nf-core/bedtools/bamtobed/environment.yml | 2 - modules/nf-core/bedtools/bamtobed/meta.yml | 43 ++-- .../bedtools/bamtobed/tests/main.nf.test | 4 +- .../bedtools/intersect/environment.yml | 2 - modules/nf-core/bedtools/intersect/meta.yml | 70 ++++--- .../bedtools/makewindows/environment.yml | 2 - modules/nf-core/bedtools/makewindows/meta.yml | 48 +++-- .../nf-core/bedtools/merge/environment.yml | 2 - modules/nf-core/bedtools/merge/meta.yml | 46 ++-- modules/nf-core/bedtools/sort/environment.yml | 2 - modules/nf-core/bedtools/sort/meta.yml | 53 ++--- modules/nf-core/busco/environment.yml | 7 - modules/nf-core/busco/main.nf | 94 --------- modules/nf-core/busco/meta.yml | 96 --------- modules/nf-core/bwamem2/index/environment.yml | 2 - modules/nf-core/bwamem2/index/meta.yml | 41 ++-- modules/nf-core/cat/cat/environment.yml | 2 - modules/nf-core/cat/cat/main.nf | 1 - modules/nf-core/cat/cat/meta.yml | 39 ++-- modules/nf-core/cat/cat/tests/main.nf.test | 48 +++-- .../nf-core/cat/cat/tests/main.nf.test.snap | 128 +++++------ .../dumpsoftwareversions/environment.yml | 4 +- .../custom/dumpsoftwareversions/main.nf | 4 +- .../custom/dumpsoftwareversions/meta.yml | 36 ++-- .../templates/dumpsoftwareversions.py | 4 +- .../getchromsizes/custom-getchromsizes.diff | 44 ++-- .../custom/getchromsizes/environment.yml | 6 +- modules/nf-core/custom/getchromsizes/main.nf | 27 ++- modules/nf-core/custom/getchromsizes/meta.yml | 67 +++--- .../custom/getchromsizes/tests/main.nf.test | 51 ++++- .../getchromsizes/tests/main.nf.test.snap | 140 ++++++++++++- modules/nf-core/gnu/sort/environment.yml | 6 +- modules/nf-core/gnu/sort/main.nf | 13 +- modules/nf-core/gnu/sort/meta.yml | 41 ++-- .../nf-core/minimap2/index/environment.yml | 4 +- modules/nf-core/minimap2/index/main.nf | 16 +- modules/nf-core/minimap2/index/meta.yml | 43 ++-- .../nf-core/miniprot/align/environment.yml | 2 - modules/nf-core/miniprot/align/meta.yml | 67 +++--- modules/nf-core/miniprot/index/main.nf | 2 +- modules/nf-core/miniprot/index/meta.yml | 46 ++-- .../nf-core/paftools/sam2paf/environment.yml | 2 - modules/nf-core/paftools/sam2paf/main.nf | 2 +- modules/nf-core/paftools/sam2paf/meta.yml | 38 ++-- modules/nf-core/pretextmap/main.nf | 29 +-- modules/nf-core/pretextmap/meta.yml | 70 ++++--- modules/nf-core/pretextmap/pretextmap.diff | 53 ++--- modules/nf-core/pretextsnapshot/main.nf | 15 +- modules/nf-core/pretextsnapshot/meta.yml | 52 ++--- .../pretextsnapshot/pretextsnapshot.diff | 29 ++- modules/nf-core/seqtk/cutn/environment.yml | 2 - modules/nf-core/seqtk/cutn/meta.yml | 47 +++-- .../nf-core/tabix/bgziptabix/environment.yml | 4 +- modules/nf-core/tabix/bgziptabix/main.nf | 13 +- modules/nf-core/tabix/bgziptabix/meta.yml | 70 ++++--- .../ucsc/bedgraphtobigwig/environment.yml | 4 +- modules/nf-core/ucsc/bedgraphtobigwig/main.nf | 8 +- .../nf-core/ucsc/bedgraphtobigwig/meta.yml | 53 ++--- .../ucsc/bedgraphtobigwig/tests/main.nf.test | 35 +++- .../bedgraphtobigwig/tests/main.nf.test.snap | 43 +++- modules/nf-core/ucsc/bedtobigbed/main.nf | 10 +- modules/nf-core/ucsc/bedtobigbed/meta.yml | 66 +++--- .../windowmasker/mkcounts/environment.yml | 4 +- modules/nf-core/windowmasker/mkcounts/main.nf | 8 +- .../nf-core/windowmasker/mkcounts/meta.yml | 45 ++-- .../windowmasker/ustat/environment.yml | 4 +- modules/nf-core/windowmasker/ustat/main.nf | 4 +- modules/nf-core/windowmasker/ustat/meta.yml | 63 +++--- subworkflows/local/busco_annotation.nf | 10 +- 72 files changed, 1254 insertions(+), 1088 deletions(-) delete mode 100644 modules/nf-core/busco/environment.yml delete mode 100644 modules/nf-core/busco/main.nf delete mode 100644 modules/nf-core/busco/meta.yml diff --git a/conf/base.config b/conf/base.config index 93360fc4..2d6e719c 100755 --- a/conf/base.config +++ b/conf/base.config @@ -225,14 +225,14 @@ process { memory = { check_max( 100.GB * task.attempt, 'memory' ) } } - withName: BUSCO { + withName: BUSCO_BUSCO { cpus = { check_max( 16 * task.attempt, 'cpus' ) } memory = { check_max( 50.GB * task.attempt, 'memory' ) } time = { check_max( 20.h * task.attempt, 'time' ) } } // Large Genomes > 4Gb - //withName: BUSCO { + //withName: BUSCO_BUSCO { // cpus = { check_max( 30 * task.attempt, 'cpus' ) } // memory = { check_max( 100.GB * task.attempt, 'memory' ) } // time = { check_max( 300.h * task.attempt, 'time' ) } diff --git a/conf/modules.config b/conf/modules.config index dafd5469..a5212bda 100755 --- a/conf/modules.config +++ b/conf/modules.config @@ -307,7 +307,7 @@ process { ext.prefix = { "${meta.id}_ancestral" } } - withName: "BUSCO" { + withName: "BUSCO_BUSCO" { ext.args = "--offline" } diff --git a/modules.json b/modules.json index 674b2024..36502544 100755 --- a/modules.json +++ b/modules.json @@ -7,193 +7,267 @@ "nf-core": { "bedtools/bamtobed": { "branch": "master", - "git_sha": "1d1cb7bfef6cf67fbc7faafa6992ad8bdc3045b3", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "bedtools/genomecov": { "branch": "master", "git_sha": "575e1bc54b083fb15e7dd8b5fcc40bea60e8ce83", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/intersect": { "branch": "master", - "git_sha": "575e1bc54b083fb15e7dd8b5fcc40bea60e8ce83", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "bedtools/makewindows": { "branch": "master", - "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "bedtools/map": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/merge": { "branch": "master", - "git_sha": "575e1bc54b083fb15e7dd8b5fcc40bea60e8ce83", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "bedtools/sort": { "branch": "master", - "git_sha": "575e1bc54b083fb15e7dd8b5fcc40bea60e8ce83", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, - "busco": { + "busco/busco": { "branch": "master", - "git_sha": "e3126f437c336c826f242842fe51769cfce0ec2d", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "bwamem2/index": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "cat/cat": { "branch": "master", - "git_sha": "81f27e75847087865299cc46605deb3b09b4e0a2", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "cooler/cload": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "cooler/zoomify": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "custom/dumpsoftwareversions": { "branch": "master", - "git_sha": "8ec825f465b9c17f9d83000022995b4f7de6fe93", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "custom/getchromsizes": { "branch": "master", - "git_sha": "1b0ffa4e5aed5b7e3cd4311af31bd3b2c8345051", - "installed_by": ["modules"], + "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358", + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/custom/getchromsizes/custom-getchromsizes.diff" }, "fastk/fastk": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "gnu/sort": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "merquryfk/merquryfk": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "minimap2/align": { "branch": "master", "git_sha": "603ecbd9f45300c9788f197d2a15a005685b4220", - "installed_by": ["modules"], + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/minimap2/align/minimap2-align.diff" }, "minimap2/index": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "miniprot/align": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "miniprot/index": { "branch": "master", - "git_sha": "8d737766e8f3c1417212b4b56acb959f3c356d26", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "mummer": { "branch": "master", "git_sha": "9e51255c4f8ec69fb6ccf68593392835f14fecb8", - "installed_by": ["modules"], + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/mummer/mummer.diff" }, "paftools/sam2paf": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "pretextmap": { "branch": "master", - "git_sha": "decfb802f2e573efb7b44ff06b11ecf16853054d", - "installed_by": ["modules"], + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/pretextmap/pretextmap.diff" }, "pretextsnapshot": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", - "installed_by": ["modules"], + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/pretextsnapshot/pretextsnapshot.diff" }, "samtools/faidx": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/index": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/markdup": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/merge": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/sort": { "branch": "master", "git_sha": "b7800db9b069ed505db3f9d91b8c72faea9be17b", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/view": { "branch": "master", "git_sha": "669eb24fd82a9d3cb18ad0e73673ecb26827f683", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "seqtk/cutn": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "tabix/bgziptabix": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "git_sha": "f448e846bdadd80fc8be31fbbc78d9f5b5131a45", + "installed_by": [ + "modules" + ] }, "ucsc/bedgraphtobigwig": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358", + "installed_by": [ + "modules" + ] }, "ucsc/bedtobigbed": { "branch": "master", - "git_sha": "9e51255c4f8ec69fb6ccf68593392835f14fecb8", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "windowmasker/mkcounts": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] }, "windowmasker/ustat": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": [ + "modules" + ] } } }, @@ -202,4 +276,4 @@ } } } -} +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/bamtobed/environment.yml b/modules/nf-core/bedtools/bamtobed/environment.yml index 4b50139e..5683bc05 100644 --- a/modules/nf-core/bedtools/bamtobed/environment.yml +++ b/modules/nf-core/bedtools/bamtobed/environment.yml @@ -1,7 +1,5 @@ -name: bedtools_bamtobed channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/bamtobed/meta.yml b/modules/nf-core/bedtools/bamtobed/meta.yml index b6d14929..20171885 100644 --- a/modules/nf-core/bedtools/bamtobed/meta.yml +++ b/modules/nf-core/bedtools/bamtobed/meta.yml @@ -12,30 +12,33 @@ tools: A set of tools for genomic analysis tasks, specifically enabling genome arithmetic (merge, count, complement) on various file types. documentation: https://bedtools.readthedocs.io/en/latest/content/tools/complement.html licence: ["MIT"] + identifier: biotools:bedtools input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - bam: - type: file - description: Input BAM file - pattern: "*.{bam}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: Input BAM file + pattern: "*.{bam}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - bed: - type: file - description: Bed file containing genomic intervals. - pattern: "*.{bed}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bed": + type: file + description: Bed file containing genomic intervals. + pattern: "*.{bed}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@yuukiiwa" - "@drpatelh" diff --git a/modules/nf-core/bedtools/bamtobed/tests/main.nf.test b/modules/nf-core/bedtools/bamtobed/tests/main.nf.test index 9c65ef70..297f1813 100644 --- a/modules/nf-core/bedtools/bamtobed/tests/main.nf.test +++ b/modules/nf-core/bedtools/bamtobed/tests/main.nf.test @@ -14,7 +14,7 @@ nextflow_process { """ input[0] = [ [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_single_end_bam'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.bam', checkIfExists: true) ] """ } @@ -38,7 +38,7 @@ nextflow_process { """ input[0] = [ [ id:'test' ], // meta map - file(params.test_data['sarscov2']['illumina']['test_single_end_bam'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.bam', checkIfExists: true) ] """ } diff --git a/modules/nf-core/bedtools/intersect/environment.yml b/modules/nf-core/bedtools/intersect/environment.yml index 2a343050..5683bc05 100644 --- a/modules/nf-core/bedtools/intersect/environment.yml +++ b/modules/nf-core/bedtools/intersect/environment.yml @@ -1,7 +1,5 @@ -name: bedtools_intersect channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/intersect/meta.yml b/modules/nf-core/bedtools/intersect/meta.yml index 0939cb54..45ecf377 100644 --- a/modules/nf-core/bedtools/intersect/meta.yml +++ b/modules/nf-core/bedtools/intersect/meta.yml @@ -10,43 +10,47 @@ tools: A set of tools for genomic analysis tasks, specifically enabling genome arithmetic (merge, count, complement) on various file types. documentation: https://bedtools.readthedocs.io/en/latest/content/tools/intersect.html licence: ["MIT"] + identifier: biotools:bedtools input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - intervals1: - type: file - description: BAM/BED/GFF/VCF - pattern: "*.{bam|bed|gff|vcf}" - - intervals2: - type: file - description: BAM/BED/GFF/VCF - pattern: "*.{bam|bed|gff|vcf}" - - meta2: - type: map - description: | - Groovy Map containing reference chromosome sizes - e.g. [ id:'test' ] - - chrom_sizes: - type: file - description: Chromosome sizes file - pattern: "*{.sizes,.txt}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - intervals1: + type: file + description: BAM/BED/GFF/VCF + pattern: "*.{bam|bed|gff|vcf}" + - intervals2: + type: file + description: BAM/BED/GFF/VCF + pattern: "*.{bam|bed|gff|vcf}" + - - meta2: + type: map + description: | + Groovy Map containing reference chromosome sizes + e.g. [ id:'test' ] + - chrom_sizes: + type: file + description: Chromosome sizes file + pattern: "*{.sizes,.txt}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - intersect: - type: file - description: File containing the description of overlaps found between the two features - pattern: "*.${extension}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.${extension}": + type: file + description: File containing the description of overlaps found between the two + features + pattern: "*.${extension}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@edmundmiller" - "@sruthipsuresh" diff --git a/modules/nf-core/bedtools/makewindows/environment.yml b/modules/nf-core/bedtools/makewindows/environment.yml index 0de3c15d..5683bc05 100644 --- a/modules/nf-core/bedtools/makewindows/environment.yml +++ b/modules/nf-core/bedtools/makewindows/environment.yml @@ -1,7 +1,5 @@ -name: bedtools_makewindows channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/makewindows/meta.yml b/modules/nf-core/bedtools/makewindows/meta.yml index f89d7175..df047f66 100644 --- a/modules/nf-core/bedtools/makewindows/meta.yml +++ b/modules/nf-core/bedtools/makewindows/meta.yml @@ -7,35 +7,39 @@ keywords: - chunking tools: - bedtools: - description: A set of tools for genomic analysis tasks, specifically enabling genome arithmetic (merge, count, complement) on various file types. + description: A set of tools for genomic analysis tasks, specifically enabling + genome arithmetic (merge, count, complement) on various file types. homepage: https://bedtools.readthedocs.io documentation: https://bedtools.readthedocs.io/en/latest/content/tools/makewindows.html doi: "10.1093/bioinformatics/btq033" licence: ["MIT"] + identifier: biotools:bedtools input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - regions: - type: file - description: BED file OR Genome details file () - pattern: "*.{bed,tab,fai}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - regions: + type: file + description: BED file OR Genome details file () + pattern: "*.{bed,tab,fai}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - bed: - type: file - description: BED file containing the windows - pattern: "*.bed" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bed": + type: file + description: BED file containing the windows + pattern: "*.bed" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@kevbrick" - "@nvnieuwk" diff --git a/modules/nf-core/bedtools/merge/environment.yml b/modules/nf-core/bedtools/merge/environment.yml index 99707878..5683bc05 100644 --- a/modules/nf-core/bedtools/merge/environment.yml +++ b/modules/nf-core/bedtools/merge/environment.yml @@ -1,7 +1,5 @@ -name: bedtools_merge channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/merge/meta.yml b/modules/nf-core/bedtools/merge/meta.yml index d7463e3d..6da54205 100644 --- a/modules/nf-core/bedtools/merge/meta.yml +++ b/modules/nf-core/bedtools/merge/meta.yml @@ -1,5 +1,6 @@ name: bedtools_merge -description: combines overlapping or “book-ended” features in an interval file into a single feature which spans all of the combined features. +description: combines overlapping or “book-ended” features in an interval file into + a single feature which spans all of the combined features. keywords: - bed - merge @@ -11,30 +12,33 @@ tools: A set of tools for genomic analysis tasks, specifically enabling genome arithmetic (merge, count, complement) on various file types. documentation: https://bedtools.readthedocs.io/en/latest/content/tools/merge.html licence: ["MIT"] + identifier: biotools:bedtools input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - bed: - type: file - description: Input BED file - pattern: "*.{bed}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bed: + type: file + description: Input BED file + pattern: "*.{bed}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - bed: - type: file - description: Overlapped bed file with combined features - pattern: "*.{bed}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bed": + type: file + description: Overlapped bed file with combined features + pattern: "*.{bed}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@edmundmiller" - "@sruthipsuresh" diff --git a/modules/nf-core/bedtools/sort/environment.yml b/modules/nf-core/bedtools/sort/environment.yml index 87b2e425..5683bc05 100644 --- a/modules/nf-core/bedtools/sort/environment.yml +++ b/modules/nf-core/bedtools/sort/environment.yml @@ -1,7 +1,5 @@ -name: bedtools_sort channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::bedtools=2.31.1 diff --git a/modules/nf-core/bedtools/sort/meta.yml b/modules/nf-core/bedtools/sort/meta.yml index 7c915f5f..313698f1 100644 --- a/modules/nf-core/bedtools/sort/meta.yml +++ b/modules/nf-core/bedtools/sort/meta.yml @@ -11,35 +11,38 @@ tools: A set of tools for genomic analysis tasks, specifically enabling genome arithmetic (merge, count, complement) on various file types. documentation: https://bedtools.readthedocs.io/en/latest/content/tools/sort.html licence: ["MIT"] + identifier: biotools:bedtools input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - intervals: - type: file - description: BED/BEDGRAPH - pattern: "*.{bed|bedGraph}" - - genome_file: - type: file - description: | - Optional reference genome 2 column file that defines the expected chromosome order. - pattern: "*.{fai,txt,chromsizes}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - intervals: + type: file + description: BED/BEDGRAPH + pattern: "*.{bed|bedGraph}" + - - genome_file: + type: file + description: | + Optional reference genome 2 column file that defines the expected chromosome order. + pattern: "*.{fai,txt,chromsizes}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - sorted: - type: file - description: Sorted output file - pattern: "*.${extension}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.${extension}": + type: file + description: Sorted output file + pattern: "*.${extension}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@edmundmiller" - "@sruthipsuresh" diff --git a/modules/nf-core/busco/environment.yml b/modules/nf-core/busco/environment.yml deleted file mode 100644 index f872d057..00000000 --- a/modules/nf-core/busco/environment.yml +++ /dev/null @@ -1,7 +0,0 @@ -name: busco -channels: - - conda-forge - - bioconda - - defaults -dependencies: - - bioconda::busco=5.5.0 diff --git a/modules/nf-core/busco/main.nf b/modules/nf-core/busco/main.nf deleted file mode 100644 index e7100405..00000000 --- a/modules/nf-core/busco/main.nf +++ /dev/null @@ -1,94 +0,0 @@ -process BUSCO { - tag "$meta.id" - label 'process_medium' - - conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/busco:5.5.0--pyhdfd78af_0': - 'biocontainers/busco:5.5.0--pyhdfd78af_0' }" - - input: - tuple val(meta), path('tmp_input/*') - val mode // Required: One of genome, proteins, or transcriptome - val lineage // Required: lineage to check against, "auto" enables --auto-lineage instead - path busco_lineages_path // Recommended: path to busco lineages - downloads if not set - path config_file // Optional: busco configuration file - - output: - tuple val(meta), path("*-busco.batch_summary.txt") , emit: batch_summary - tuple val(meta), path("short_summary.*.txt") , emit: short_summaries_txt, optional: true - tuple val(meta), path("short_summary.*.json") , emit: short_summaries_json, optional: true - tuple val(meta), path("*-busco/*/run_*/full_table.tsv") , emit: full_table, optional: true - tuple val(meta), path("*-busco/*/run_*/missing_busco_list.tsv") , emit: missing_busco_list, optional: true - tuple val(meta), path("*-busco/*/run_*/single_copy_proteins.faa") , emit: single_copy_proteins, optional: true - tuple val(meta), path("*-busco/*/run_*/busco_sequences") , emit: seq_dir - tuple val(meta), path("*-busco/*/translated_proteins") , emit: translated_dir, optional: true - tuple val(meta), path("*-busco") , emit: busco_dir - path "versions.yml" , emit: versions - - when: - task.ext.when == null || task.ext.when - - script: - if ( mode !in [ 'genome', 'proteins', 'transcriptome' ] ) { - error "Mode must be one of 'genome', 'proteins', or 'transcriptome'." - } - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}-${lineage}" - def busco_config = config_file ? "--config $config_file" : '' - def busco_lineage = lineage.equals('auto') ? '--auto-lineage' : "--lineage_dataset ${lineage}" - def busco_lineage_dir = busco_lineages_path ? "--download_path ${busco_lineages_path}" : '' - """ - # Nextflow changes the container --entrypoint to /bin/bash (container default entrypoint: /usr/local/env-execute) - # Check for container variable initialisation script and source it. - if [ -f "/usr/local/env-activate.sh" ]; then - set +u # Otherwise, errors out because of various unbound variables - . "/usr/local/env-activate.sh" - set -u - fi - - # If the augustus config directory is not writable, then copy to writeable area - if [ ! -w "\${AUGUSTUS_CONFIG_PATH}" ]; then - # Create writable tmp directory for augustus - AUG_CONF_DIR=\$( mktemp -d -p \$PWD ) - cp -r \$AUGUSTUS_CONFIG_PATH/* \$AUG_CONF_DIR - export AUGUSTUS_CONFIG_PATH=\$AUG_CONF_DIR - echo "New AUGUSTUS_CONFIG_PATH=\${AUGUSTUS_CONFIG_PATH}" - fi - - # Ensure the input is uncompressed - INPUT_SEQS=input_seqs - mkdir "\$INPUT_SEQS" - cd "\$INPUT_SEQS" - for FASTA in ../tmp_input/*; do - if [ "\${FASTA##*.}" == 'gz' ]; then - gzip -cdf "\$FASTA" > \$( basename "\$FASTA" .gz ) - else - ln -s "\$FASTA" . - fi - done - cd .. - - busco \\ - --cpu $task.cpus \\ - --in "\$INPUT_SEQS" \\ - --out ${prefix}-busco \\ - --mode $mode \\ - $busco_lineage \\ - $busco_lineage_dir \\ - $busco_config \\ - $args - - # clean up - rm -rf "\$INPUT_SEQS" - - # Move files to avoid staging/publishing issues - mv ${prefix}-busco/batch_summary.txt ${prefix}-busco.batch_summary.txt - mv ${prefix}-busco/*/short_summary.*.{json,txt} . || echo "Short summaries were not available: No genes were found." - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - busco: \$( busco --version 2>&1 | sed 's/^BUSCO //' ) - END_VERSIONS - """ -} diff --git a/modules/nf-core/busco/meta.yml b/modules/nf-core/busco/meta.yml deleted file mode 100644 index 90b30d4d..00000000 --- a/modules/nf-core/busco/meta.yml +++ /dev/null @@ -1,96 +0,0 @@ -name: busco -description: Benchmarking Universal Single Copy Orthologs -keywords: - - quality control - - genome - - transcriptome - - proteome -tools: - - busco: - description: BUSCO provides measures for quantitative assessment of genome assembly, gene set, and transcriptome completeness based on evolutionarily informed expectations of gene content from near-universal single-copy orthologs selected from OrthoDB. - homepage: https://busco.ezlab.org/ - documentation: https://busco.ezlab.org/busco_userguide.html - tool_dev_url: https://gitlab.com/ezlab/busco - doi: "10.1007/978-1-4939-9173-0_14" - licence: ["MIT"] -input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: Nucleic or amino acid sequence file in FASTA format. - pattern: "*.{fasta,fna,fa,fasta.gz,fna.gz,fa.gz}" - - mode: - type: string - description: The mode to run Busco in. One of genome, proteins, or transcriptome - pattern: "{genome,proteins,transcriptome}" - - lineage: - type: string - description: The BUSCO lineage to use, or "auto" to automatically select lineage - - busco_lineages_path: - type: directory - description: Path to local BUSCO lineages directory. - - config_file: - type: file - description: Path to BUSCO config file. -output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - batch_summary: - type: file - description: Summary of all sequence files analyzed - pattern: "*-busco.batch_summary.txt" - - short_summaries_txt: - type: file - description: Short Busco summary in plain text format - pattern: "short_summary.*.txt" - - short_summaries_json: - type: file - description: Short Busco summary in JSON format - pattern: "short_summary.*.json" - - busco_dir: - type: directory - description: BUSCO lineage specific output - pattern: "*-busco" - - full_table: - type: file - description: Full BUSCO results table - pattern: "full_table.tsv" - - missing_busco_list: - type: file - description: List of missing BUSCOs - pattern: "missing_busco_list.tsv" - - single_copy_proteins: - type: file - description: Fasta file of single copy proteins (transcriptome mode) - pattern: "single_copy_proteins.faa" - - seq_dir: - type: directory - description: BUSCO sequence directory - pattern: "busco_sequences" - - translated_proteins: - type: directory - description: Six frame translations of each transcript made by the transcriptome mode - pattern: "translated_proteins" - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" -authors: - - "@priyanka-surana" - - "@charles-plessy" - - "@mahesh-panchal" - - "@muffato" - - "@jvhagey" -maintainers: - - "@priyanka-surana" - - "@charles-plessy" - - "@mahesh-panchal" - - "@muffato" - - "@jvhagey" diff --git a/modules/nf-core/bwamem2/index/environment.yml b/modules/nf-core/bwamem2/index/environment.yml index 26b43917..15cee238 100644 --- a/modules/nf-core/bwamem2/index/environment.yml +++ b/modules/nf-core/bwamem2/index/environment.yml @@ -1,7 +1,5 @@ -name: bwamem2_index channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::bwa-mem2=2.2.1 diff --git a/modules/nf-core/bwamem2/index/meta.yml b/modules/nf-core/bwamem2/index/meta.yml index c14a1092..74f54ef0 100644 --- a/modules/nf-core/bwamem2/index/meta.yml +++ b/modules/nf-core/bwamem2/index/meta.yml @@ -13,29 +13,32 @@ tools: homepage: https://github.com/bwa-mem2/bwa-mem2 documentation: https://github.com/bwa-mem2/bwa-mem2#usage licence: ["MIT"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: Input genome fasta file + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Input genome fasta file output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - index: - type: file - description: BWA genome index files - pattern: "*.{0123,amb,ann,bwt.2bit.64,pac}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bwamem2: + type: file + description: BWA genome index files + pattern: "*.{0123,amb,ann,bwt.2bit.64,pac}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@maxulysse" maintainers: diff --git a/modules/nf-core/cat/cat/environment.yml b/modules/nf-core/cat/cat/environment.yml index 17a04ef2..9b01c865 100644 --- a/modules/nf-core/cat/cat/environment.yml +++ b/modules/nf-core/cat/cat/environment.yml @@ -1,7 +1,5 @@ -name: cat_cat channels: - conda-forge - bioconda - - defaults dependencies: - conda-forge::pigz=2.3.4 diff --git a/modules/nf-core/cat/cat/main.nf b/modules/nf-core/cat/cat/main.nf index adbdbd7b..2862c64c 100644 --- a/modules/nf-core/cat/cat/main.nf +++ b/modules/nf-core/cat/cat/main.nf @@ -76,4 +76,3 @@ def getFileSuffix(filename) { def match = filename =~ /^.*?((\.\w{1,5})?(\.\w{1,5}\.gz$))/ return match ? match[0][1] : filename.substring(filename.lastIndexOf('.')) } - diff --git a/modules/nf-core/cat/cat/meta.yml b/modules/nf-core/cat/cat/meta.yml index 00a8db0b..81778a06 100644 --- a/modules/nf-core/cat/cat/meta.yml +++ b/modules/nf-core/cat/cat/meta.yml @@ -9,25 +9,32 @@ tools: description: Just concatenation documentation: https://man7.org/linux/man-pages/man1/cat.1.html licence: ["GPL-3.0-or-later"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - files_in: - type: file - description: List of compressed / uncompressed files - pattern: "*" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - files_in: + type: file + description: List of compressed / uncompressed files + pattern: "*" output: - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - file_out: - type: file - description: Concatenated file. Will be gzipped if file_out ends with ".gz" - pattern: "${file_out}" + - meta: + type: file + description: Concatenated file. Will be gzipped if file_out ends with ".gz" + pattern: "${file_out}" + - ${prefix}: + type: file + description: Concatenated file. Will be gzipped if file_out ends with ".gz" + pattern: "${file_out}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@erikrikarddaniel" - "@FriederikeHanssen" diff --git a/modules/nf-core/cat/cat/tests/main.nf.test b/modules/nf-core/cat/cat/tests/main.nf.test index aaae04f9..9cb16178 100644 --- a/modules/nf-core/cat/cat/tests/main.nf.test +++ b/modules/nf-core/cat/cat/tests/main.nf.test @@ -19,8 +19,8 @@ nextflow_process { [ [ id:'genome', single_end:true ], [ - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true), - file(params.test_data['sarscov2']['genome']['genome_sizes'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true) ] ] """ @@ -29,7 +29,8 @@ nextflow_process { then { assertAll( { assert !process.success }, - { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") } + { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -45,8 +46,8 @@ nextflow_process { [ [ id:'test', single_end:true ], [ - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true), - file(params.test_data['sarscov2']['genome']['genome_sizes'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true) ] ] """ @@ -72,8 +73,8 @@ nextflow_process { [ [ id:'test', single_end:true ], [ - file(params.test_data['sarscov2']['genome']['genome_gff3_gz'], checkIfExists: true), - file(params.test_data['sarscov2']['genome']['contigs_genome_maf_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/alignment/last/contigs.genome.maf.gz', checkIfExists: true) ] ] """ @@ -83,7 +84,12 @@ nextflow_process { def lines = path(process.out.file_out.get(0).get(1)).linesGzip assertAll( { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } ) } } @@ -101,8 +107,8 @@ nextflow_process { [ [ id:'test', single_end:true ], [ - file(params.test_data['sarscov2']['genome']['genome_gff3_gz'], checkIfExists: true), - file(params.test_data['sarscov2']['genome']['contigs_genome_maf_gz'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.gff3.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/alignment/last/contigs.genome.maf.gz', checkIfExists: true) ] ] """ @@ -130,8 +136,8 @@ nextflow_process { [ [ id:'test', single_end:true ], [ - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true), - file(params.test_data['sarscov2']['genome']['genome_sizes'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.sizes', checkIfExists: true) ] ] """ @@ -141,7 +147,12 @@ nextflow_process { def lines = path(process.out.file_out.get(0).get(1)).linesGzip assertAll( { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } ) } } @@ -158,7 +169,7 @@ nextflow_process { [ [ id:'test', single_end:true ], [ - file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] ] """ @@ -168,10 +179,13 @@ nextflow_process { def lines = path(process.out.file_out.get(0).get(1)).linesGzip assertAll( { assert process.success }, - { assert snapshot(lines[0..5]).match("test_cat_one_file_unzipped_zipped_lines") }, - { assert snapshot(lines.size()).match("test_cat_one_file_unzipped_zipped_size")} + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } ) } } } - diff --git a/modules/nf-core/cat/cat/tests/main.nf.test.snap b/modules/nf-core/cat/cat/tests/main.nf.test.snap index 0c9bfe8d..b7623ee6 100644 --- a/modules/nf-core/cat/cat/tests/main.nf.test.snap +++ b/modules/nf-core/cat/cat/tests/main.nf.test.snap @@ -28,6 +28,10 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, "timestamp": "2023-10-16T14:32:18.500464399" }, "test_cat_zipped_unzipped": { @@ -59,40 +63,46 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, "timestamp": "2023-10-16T14:32:49.642741302" }, "test_cat_zipped_zipped": { "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "test.gff3.gz:md5,c439d3b60e7bc03e8802a451a0d9a5d9" - ] - ], - "1": [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ], - "file_out": [ - [ - { - "id": "test", - "single_end": true - }, - "test.gff3.gz:md5,c439d3b60e7bc03e8802a451a0d9a5d9" - ] - ], - "versions": [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ] - } + [ + "MT192765.1\tGenbank\ttranscript\t259\t29667\t.\t+\t.\tID=unknown_transcript_1;geneID=orf1ab;gene_name=orf1ab", + "MT192765.1\tGenbank\tgene\t259\t21548\t.\t+\t.\tParent=unknown_transcript_1", + "MT192765.1\tGenbank\tCDS\t259\t13461\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1", + "MT192765.1\tGenbank\tCDS\t13461\t21548\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1", + "MT192765.1\tGenbank\tCDS\t21556\t25377\t.\t+\t0\tParent=unknown_transcript_1;gbkey=CDS;gene=S;note=\"structural protein\";product=\"surface glycoprotein\";protein_id=QIK50427.1", + "MT192765.1\tGenbank\tgene\t21556\t25377\t.\t+\t.\tParent=unknown_transcript_1" + ], + 78, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] ], - "timestamp": "2024-01-12T14:02:02.999254641" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:46.802978" }, - "test_cat_one_file_unzipped_zipped_lines": { + "test_cat_name_conflict": { + "content": [ + [ + + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:29.45394" + }, + "test_cat_one_file_unzipped_zipped": { "content": [ [ ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", @@ -101,45 +111,37 @@ "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ], + 374, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" ] ], - "timestamp": "2023-10-16T14:33:21.39642399" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:52:02.774016" }, "test_cat_unzipped_zipped": { "content": [ - { - "0": [ - [ - { - "id": "test", - "single_end": true - }, - "cat.txt.gz:md5,f44b33a0e441ad58b2d3700270e2dbe2" - ] - ], - "1": [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ], - "file_out": [ - [ - { - "id": "test", - "single_end": true - }, - "cat.txt.gz:md5,f44b33a0e441ad58b2d3700270e2dbe2" - ] - ], - "versions": [ - "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" - ] - } - ], - "timestamp": "2024-01-12T14:08:26.948048418" - }, - "test_cat_one_file_unzipped_zipped_size": { - "content": [ - 374 + [ + ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", + "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT", + "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG", + "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", + "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", + "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ], + 375, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] ], - "timestamp": "2024-01-12T14:10:22.445700266" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:57.581523" } -} +} \ No newline at end of file diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml index 9b3272bc..9d79af93 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/environment.yml +++ b/modules/nf-core/custom/dumpsoftwareversions/environment.yml @@ -1,7 +1,5 @@ -name: custom_dumpsoftwareversions channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::multiqc=1.19 + - bioconda::multiqc=1.20 diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf index f2187611..105f9265 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/main.nf +++ b/modules/nf-core/custom/dumpsoftwareversions/main.nf @@ -4,8 +4,8 @@ process CUSTOM_DUMPSOFTWAREVERSIONS { // Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.19--pyhdfd78af_0' : - 'biocontainers/multiqc:1.19--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.20--pyhdfd78af_0' : + 'biocontainers/multiqc:1.20--pyhdfd78af_0' }" input: path versions diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml index 5f15a5fd..dc1e412f 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/meta.yml +++ b/modules/nf-core/custom/dumpsoftwareversions/meta.yml @@ -1,34 +1,40 @@ # yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json name: custom_dumpsoftwareversions -description: Custom module used to dump software versions within the nf-core pipeline template +description: Custom module used to dump software versions within the nf-core pipeline + template keywords: - custom - dump - version tools: - custom: - description: Custom module used to dump software versions within the nf-core pipeline template + description: Custom module used to dump software versions within the nf-core pipeline + template homepage: https://github.com/nf-core/tools documentation: https://github.com/nf-core/tools licence: ["MIT"] + identifier: "" input: - - versions: - type: file - description: YML file containing software versions - pattern: "*.yml" + - - versions: + type: file + description: YML file containing software versions + pattern: "*.yml" output: - yml: - type: file - description: Standard YML file containing software versions - pattern: "software_versions.yml" + - software_versions.yml: + type: file + description: Standard YML file containing software versions + pattern: "software_versions.yml" - mqc_yml: - type: file - description: MultiQC custom content YML file containing software versions - pattern: "software_versions_mqc.yml" + - software_versions_mqc.yml: + type: file + description: MultiQC custom content YML file containing software versions + pattern: "software_versions_mqc.yml" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@grst" diff --git a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py index da033408..b83b32c4 100755 --- a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py +++ b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py @@ -3,11 +3,11 @@ """Provide functions to merge multiple versions.yml files.""" - -import yaml import platform from textwrap import dedent +import yaml + def _make_versions_html(versions): """Generate a tabular HTML output of all versions for MultiQC.""" diff --git a/modules/nf-core/custom/getchromsizes/custom-getchromsizes.diff b/modules/nf-core/custom/getchromsizes/custom-getchromsizes.diff index 216925e6..b05f08cc 100644 --- a/modules/nf-core/custom/getchromsizes/custom-getchromsizes.diff +++ b/modules/nf-core/custom/getchromsizes/custom-getchromsizes.diff @@ -1,15 +1,10 @@ Changes in module 'nf-core/custom/getchromsizes' +'modules/nf-core/custom/getchromsizes/meta.yml' is unchanged +Changes in 'custom/getchromsizes/main.nf': --- modules/nf-core/custom/getchromsizes/main.nf +++ modules/nf-core/custom/getchromsizes/main.nf -@@ -1,5 +1,5 @@ - process CUSTOM_GETCHROMSIZES { -- tag "$fasta" -+ tag "$meta.id" - label 'process_single' - - conda "bioconda::samtools=1.16.1" -@@ -8,22 +8,26 @@ - 'biocontainers/samtools:1.16.1--h6899075_1' }" +@@ -8,22 +8,25 @@ + 'biocontainers/samtools:1.21--h50ea8bc_0' }" input: - tuple val(meta), path(fasta) @@ -21,18 +16,16 @@ Changes in module 'nf-core/custom/getchromsizes' - tuple val(meta), path ("*.fai") , emit: fai - tuple val(meta), path ("*.gzi") , emit: gzi, optional: true - path "versions.yml" , emit: versions -+ tuple val(meta), path ("*.${suffix}") , emit: sizes -+ tuple val(meta), path ("*.fa") , emit: fasta -+ tuple val(meta), path ("*.fai") , emit: fai -+ tuple val(meta), path ("*.gzi") , emit: gzi, optional: true -+ path "versions.yml" , emit: versions ++ tuple val(meta), path ("*.${suffix}"), emit: sizes ++ tuple val(meta), path ("*.fai"), emit: fai ++ tuple val(meta), path ("*.gzi"), emit: gzi, optional: true ++ path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when script: -- def args = task.ext.args ?: '' -+ def args = task.ext.args ?: '' + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" """ - samtools faidx $fasta @@ -43,20 +36,9 @@ Changes in module 'nf-core/custom/getchromsizes' cat <<-END_VERSIONS > versions.yml "${task.process}": -@@ -32,9 +36,12 @@ - """ - - stub: -+ def prefix = task.ext.prefix ?: "${meta.id}" -+ def suffix = 'temp.genome' - """ -- touch ${fasta}.fai -- touch ${fasta}.sizes -+ ln -s ${fasta} ${prefix}.fa -+ touch ${prefix}.fa.fai -+ touch ${prefix}.${suffix} - - cat <<-END_VERSIONS > versions.yml - "${task.process}": +'modules/nf-core/custom/getchromsizes/environment.yml' is unchanged +'modules/nf-core/custom/getchromsizes/tests/main.nf.test' is unchanged +'modules/nf-core/custom/getchromsizes/tests/tags.yml' is unchanged +'modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap' is unchanged ************************************************************ diff --git a/modules/nf-core/custom/getchromsizes/environment.yml b/modules/nf-core/custom/getchromsizes/environment.yml index 2a01695f..2bcd47ee 100644 --- a/modules/nf-core/custom/getchromsizes/environment.yml +++ b/modules/nf-core/custom/getchromsizes/environment.yml @@ -1,7 +1,7 @@ -name: custom_getchromsizes channels: - conda-forge - bioconda - - defaults + dependencies: - - bioconda::samtools=1.16.1 + - bioconda::htslib=1.21 + - bioconda::samtools=1.21 diff --git a/modules/nf-core/custom/getchromsizes/main.nf b/modules/nf-core/custom/getchromsizes/main.nf index 146f501e..263ddc7d 100644 --- a/modules/nf-core/custom/getchromsizes/main.nf +++ b/modules/nf-core/custom/getchromsizes/main.nf @@ -1,28 +1,27 @@ process CUSTOM_GETCHROMSIZES { - tag "$meta.id" + tag "$fasta" label 'process_single' conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.16.1--h6899075_1' : - 'biocontainers/samtools:1.16.1--h6899075_1' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.21--h50ea8bc_0' : + 'biocontainers/samtools:1.21--h50ea8bc_0' }" input: tuple val(meta), path(fasta, stageAs: 'input/*') val suffix output: - tuple val(meta), path ("*.${suffix}") , emit: sizes - tuple val(meta), path ("*.fa") , emit: fasta - tuple val(meta), path ("*.fai") , emit: fai - tuple val(meta), path ("*.gzi") , emit: gzi, optional: true - path "versions.yml" , emit: versions + tuple val(meta), path ("*.${suffix}"), emit: sizes + tuple val(meta), path ("*.fai"), emit: fai + tuple val(meta), path ("*.gzi"), emit: gzi, optional: true + path "versions.yml", emit: versions when: task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' + def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" """ ln -s ${fasta} ${prefix}.fa @@ -36,12 +35,12 @@ process CUSTOM_GETCHROMSIZES { """ stub: - def prefix = task.ext.prefix ?: "${meta.id}" - def suffix = 'temp.genome' """ - ln -s ${fasta} ${prefix}.fa - touch ${prefix}.fa.fai - touch ${prefix}.${suffix} + touch ${fasta}.fai + touch ${fasta}.sizes + if [[ "${fasta.extension}" == "gz" ]]; then + touch ${fasta}.gzi + fi cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/custom/getchromsizes/meta.yml b/modules/nf-core/custom/getchromsizes/meta.yml index 529be07e..2a0e8da0 100644 --- a/modules/nf-core/custom/getchromsizes/meta.yml +++ b/modules/nf-core/custom/getchromsizes/meta.yml @@ -12,38 +12,53 @@ tools: tool_dev_url: https://github.com/samtools/samtools doi: 10.1093/bioinformatics/btp352 licence: ["MIT"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: FASTA file - pattern: "*.{fa,fasta,fna,fas}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: FASTA file + pattern: "*.{fa,fasta,fna,fas}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - sizes: - type: file - description: File containing chromosome lengths - pattern: "*.{sizes}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.sizes": + type: file + description: File containing chromosome lengths + pattern: "*.{sizes}" - fai: - type: file - description: FASTA index file - pattern: "*.{fai}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.fai": + type: file + description: FASTA index file + pattern: "*.{fai}" - gzi: - type: file - description: Optional gzip index file for compressed inputs - pattern: "*.gzi" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.gzi": + type: file + description: Optional gzip index file for compressed inputs + pattern: "*.gzi" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@tamara-hodgetts" - "@chris-cheshire" diff --git a/modules/nf-core/custom/getchromsizes/tests/main.nf.test b/modules/nf-core/custom/getchromsizes/tests/main.nf.test index 9f6b5640..2f741a4b 100644 --- a/modules/nf-core/custom/getchromsizes/tests/main.nf.test +++ b/modules/nf-core/custom/getchromsizes/tests/main.nf.test @@ -12,9 +12,6 @@ nextflow_process { test("test_custom_getchromsizes") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -31,15 +28,11 @@ nextflow_process { { assert snapshot(process.out).match() } ) } - } test("test_custom_getchromsizes_bgzip") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -56,7 +49,51 @@ nextflow_process { { assert snapshot(process.out).match() } ) } + } + + test("test_custom_getchromsizes - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } } + test("test_custom_getchromsizes_bgzip - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap b/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap index 2e560bd3..d2072e22 100644 --- a/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap +++ b/modules/nf-core/custom/getchromsizes/tests/main.nf.test.snap @@ -1,4 +1,69 @@ { + "test_custom_getchromsizes_bgzip - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.gzi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,f68edc4d5999d8cb07147b9be115d60b" + ], + "fai": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "gzi": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.gzi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "sizes": [ + [ + { + "id": "test" + }, + "genome.fasta.gz.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,f68edc4d5999d8cb07147b9be115d60b" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T10:11:37.459094476" + }, "test_custom_getchromsizes": { "content": [ { @@ -22,7 +87,7 @@ ], "3": [ - "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8" + "versions.yml:md5,f68edc4d5999d8cb07147b9be115d60b" ], "fai": [ [ @@ -44,11 +109,15 @@ ] ], "versions": [ - "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8" + "versions.yml:md5,f68edc4d5999d8cb07147b9be115d60b" ] } ], - "timestamp": "2024-01-17T17:48:35.562918" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T10:11:01.526301351" }, "test_custom_getchromsizes_bgzip": { "content": [ @@ -78,7 +147,7 @@ ] ], "3": [ - "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8" + "versions.yml:md5,f68edc4d5999d8cb07147b9be115d60b" ], "fai": [ [ @@ -105,10 +174,69 @@ ] ], "versions": [ - "versions.yml:md5,45a83c5f3dddbc5dcab30035169f7ce8" + "versions.yml:md5,f68edc4d5999d8cb07147b9be115d60b" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T10:11:14.32456385" + }, + "test_custom_getchromsizes - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test" + }, + "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,f68edc4d5999d8cb07147b9be115d60b" + ], + "fai": [ + [ + { + "id": "test" + }, + "genome.fasta.fai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "gzi": [ + + ], + "sizes": [ + [ + { + "id": "test" + }, + "genome.fasta.sizes:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,f68edc4d5999d8cb07147b9be115d60b" ] } ], - "timestamp": "2024-01-17T17:49:02.562311" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T10:11:26.505487624" } } \ No newline at end of file diff --git a/modules/nf-core/gnu/sort/environment.yml b/modules/nf-core/gnu/sort/environment.yml index 45d23356..babcfb55 100644 --- a/modules/nf-core/gnu/sort/environment.yml +++ b/modules/nf-core/gnu/sort/environment.yml @@ -1,7 +1,7 @@ -name: GNU_SORT +--- +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/environment-schema.json channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::coreutils=8.25 + - conda-forge::coreutils=9.3 diff --git a/modules/nf-core/gnu/sort/main.nf b/modules/nf-core/gnu/sort/main.nf index 108a70a8..e1167666 100644 --- a/modules/nf-core/gnu/sort/main.nf +++ b/modules/nf-core/gnu/sort/main.nf @@ -1,11 +1,11 @@ process GNU_SORT { - tag "${meta.id}" + tag "$meta.id" label "process_low" conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/coreutils:8.25--1' : - 'biocontainers/coreutils:8.25--1' }" + 'https://depot.galaxyproject.org/singularity/coreutils:9.3': + 'biocontainers/coreutils:9.3' }" input: tuple val(meta), path(input) @@ -22,7 +22,7 @@ process GNU_SORT { def prefix = task.ext.prefix ?: "${meta.id}" suffix = task.ext.suffix ?: "${input.extension}" output_file = "${prefix}.${suffix}" - def VERSION = "9.1" // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. + def VERSION = "9.3" // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. if ("$input" == "$output_file") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" """ sort ${args} ${input} > ${output_file} @@ -34,15 +34,14 @@ process GNU_SORT { """ stub: - def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" suffix = task.ext.suffix ?: "${input.extension}" output_file = "${prefix}.${suffix}" - def VERSION = "9.1" + def VERSION = "9.3" if ("$input" == "$output_file") error "Input and output names are the same, use \"task.ext.prefix\" to disambiguate!" """ - sort ${args} ${input} > ${output_file} + touch ${output_file} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/gnu/sort/meta.yml b/modules/nf-core/gnu/sort/meta.yml index 014bcd52..c555dbb5 100644 --- a/modules/nf-core/gnu/sort/meta.yml +++ b/modules/nf-core/gnu/sort/meta.yml @@ -1,4 +1,4 @@ -name: "GNU_SORT" +name: "gnu_sort" description: | Writes a sorted concatenation of file/s keywords: @@ -11,30 +11,29 @@ tools: homepage: "https://github.com/vgl-hub/gfastats" documentation: "https://www.gnu.org/software/coreutils/manual/html_node/sort-invocation.html" licence: ["GPL"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - input: - type: file - description: Draft assembly file - pattern: "*.{txt,bed,interval,genome,bins}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: Draft assembly file + pattern: "*.{txt,bed,interval,genome,bins}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - sorted: - type: file - description: The sorted txt file generated by sort - pattern: "*.{txt,bed,interval,genome,bins}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@DLBPointon" maintainers: diff --git a/modules/nf-core/minimap2/index/environment.yml b/modules/nf-core/minimap2/index/environment.yml index 2a66e410..d1c1b471 100644 --- a/modules/nf-core/minimap2/index/environment.yml +++ b/modules/nf-core/minimap2/index/environment.yml @@ -1,7 +1,5 @@ -name: minimap2_index channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::minimap2=2.24 + - bioconda::minimap2=2.28 diff --git a/modules/nf-core/minimap2/index/main.nf b/modules/nf-core/minimap2/index/main.nf index 45e1cec0..38320214 100644 --- a/modules/nf-core/minimap2/index/main.nf +++ b/modules/nf-core/minimap2/index/main.nf @@ -1,11 +1,11 @@ process MINIMAP2_INDEX { - label 'process_medium' + label 'process_low' // Note: the versions here need to match the versions used in minimap2/align conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/minimap2:2.24--h7132678_1' : - 'biocontainers/minimap2:2.24--h7132678_1' }" + 'https://depot.galaxyproject.org/singularity/minimap2:2.28--he4a0461_0' : + 'biocontainers/minimap2:2.28--he4a0461_0' }" input: tuple val(meta), path(fasta) @@ -31,4 +31,14 @@ process MINIMAP2_INDEX { minimap2: \$(minimap2 --version 2>&1) END_VERSIONS """ + + stub: + """ + touch ${fasta.baseName}.mmi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + minimap2: \$(minimap2 --version 2>&1) + END_VERSIONS + """ } diff --git a/modules/nf-core/minimap2/index/meta.yml b/modules/nf-core/minimap2/index/meta.yml index 1d29e3f2..57c80e29 100644 --- a/modules/nf-core/minimap2/index/meta.yml +++ b/modules/nf-core/minimap2/index/meta.yml @@ -11,30 +11,33 @@ tools: homepage: https://github.com/lh3/minimap2 documentation: https://github.com/lh3/minimap2#uguide licence: ["MIT"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: | - Reference database in FASTA format. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: | + Reference database in FASTA format. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - index: - type: file - description: Minimap2 fasta index. - pattern: "*.mmi" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.mmi": + type: file + description: Minimap2 fasta index. + pattern: "*.mmi" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@yuukiiwa" - "@drpatelh" diff --git a/modules/nf-core/miniprot/align/environment.yml b/modules/nf-core/miniprot/align/environment.yml index d437e07a..7e258a04 100644 --- a/modules/nf-core/miniprot/align/environment.yml +++ b/modules/nf-core/miniprot/align/environment.yml @@ -1,7 +1,5 @@ -name: miniprot_align channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::miniprot=0.11=he4a0461_2 diff --git a/modules/nf-core/miniprot/align/meta.yml b/modules/nf-core/miniprot/align/meta.yml index 8b4ffe9e..aadd6fdf 100644 --- a/modules/nf-core/miniprot/align/meta.yml +++ b/modules/nf-core/miniprot/align/meta.yml @@ -14,40 +14,49 @@ tools: homepage: https://github.com/lh3/miniprot documentation: https://github.com/lh3/miniprot licence: ["MIT"] + identifier: biotools:miniprot input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - pep: - type: file - description: a fasta file contains one or multiple protein sequences - - meta2: - type: map - description: | - Groovy Map containing reference information - - ref: - type: file - description: Reference database in FASTA format or miniprot index format. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - pep: + type: file + description: a fasta file contains one or multiple protein sequences + - - meta2: + type: map + description: | + Groovy Map containing reference information + - ref: + type: file + description: Reference database in FASTA format or miniprot index format. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - paf: - type: file - description: Alignment in PAF format - pattern: "*.paf" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.paf": + type: file + description: Alignment in PAF format + pattern: "*.paf" - gff: - type: file - description: Alignment in gff format - pattern: "*.gff" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.gff": + type: file + description: Alignment in gff format + pattern: "*.gff" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@yumisims" - "@muffato" diff --git a/modules/nf-core/miniprot/index/main.nf b/modules/nf-core/miniprot/index/main.nf index ee3757b6..f2a036cb 100644 --- a/modules/nf-core/miniprot/index/main.nf +++ b/modules/nf-core/miniprot/index/main.nf @@ -2,7 +2,7 @@ process MINIPROT_INDEX { tag "$meta.id" label 'process_medium' - conda "bioconda::miniprot=0.11=he4a0461_2" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/miniprot:0.11--he4a0461_2': 'biocontainers/miniprot:0.11--he4a0461_2' }" diff --git a/modules/nf-core/miniprot/index/meta.yml b/modules/nf-core/miniprot/index/meta.yml index 3a098802..bd076ada 100644 --- a/modules/nf-core/miniprot/index/meta.yml +++ b/modules/nf-core/miniprot/index/meta.yml @@ -12,30 +12,36 @@ tools: homepage: https://github.com/lh3/miniprot documentation: https://github.com/lh3/miniprot licence: ["MIT"] + identifier: biotools:miniprot input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: | - Reference database in FASTA format. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: | + Reference database in FASTA format. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - index: - type: file - description: miniprot fasta index. - pattern: "*.mpi" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.mpi": + type: file + description: miniprot fasta index. + pattern: "*.mpi" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@yumisims" - "@muffato" +maintainers: + - "@yumisims" + - "@muffato" diff --git a/modules/nf-core/paftools/sam2paf/environment.yml b/modules/nf-core/paftools/sam2paf/environment.yml index a2f0c8e9..988733dd 100644 --- a/modules/nf-core/paftools/sam2paf/environment.yml +++ b/modules/nf-core/paftools/sam2paf/environment.yml @@ -1,8 +1,6 @@ -name: paftools_sam2paf channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::minimap2=2.24 - bioconda::samtools=1.14 diff --git a/modules/nf-core/paftools/sam2paf/main.nf b/modules/nf-core/paftools/sam2paf/main.nf index a9584000..914dd9ba 100644 --- a/modules/nf-core/paftools/sam2paf/main.nf +++ b/modules/nf-core/paftools/sam2paf/main.nf @@ -12,7 +12,7 @@ process PAFTOOLS_SAM2PAF { tuple val(meta), path(bam) output: - tuple val(meta), file("*.paf") , emit: paf + tuple val(meta), file("*.paf") , emit: paf path "versions.yml" , emit: versions when: diff --git a/modules/nf-core/paftools/sam2paf/meta.yml b/modules/nf-core/paftools/sam2paf/meta.yml index 438ab2dd..e5829740 100644 --- a/modules/nf-core/paftools/sam2paf/meta.yml +++ b/modules/nf-core/paftools/sam2paf/meta.yml @@ -11,30 +11,28 @@ tools: homepage: https://github.com/lh3/minimap2 documentation: https://github.com/lh3/minimap2/blob/master/README.md licence: ["MIT"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - bam: - type: file - description: An input bam file to be converted into paf. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bam: + type: file + description: An input bam file to be converted into paf. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - paf: - type: file - description: | - An output paf containing detailed data about the sample - pattern: "${prefix}.paf" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@DLBPointon" maintainers: diff --git a/modules/nf-core/pretextmap/main.nf b/modules/nf-core/pretextmap/main.nf index 87427c40..95824c45 100644 --- a/modules/nf-core/pretextmap/main.nf +++ b/modules/nf-core/pretextmap/main.nf @@ -3,24 +3,25 @@ process PRETEXTMAP { tag "$meta.id" label 'process_single' - container "quay.io/sanger-tol/pretext:0.0.2-yy5-c3" + conda "${moduleDir}/environment.yml" + container "quay.io/sanger-tol/pretext:0.0.2-yy5-c4" input: - tuple val(meta), path(input) - tuple val(meta2), path(fasta), path(genome) + tuple val(meta), path(input) + tuple val(meta2), path(fasta), path(fai) output: - tuple val(meta), path("*.pretext"), emit: pretext - path "versions.yml", emit: versions + tuple val(meta), path("*.pretext") , emit: pretext + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when script: - def VERSION = "0.1.9" - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - def reference = fasta ? "--reference ${fasta}" : "" + def VERSION = "0.1.9" + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def reference = fasta ? "--reference ${fasta}" : "" """ if [[ $input == *.pairs.gz ]]; then @@ -39,21 +40,21 @@ process PRETEXTMAP { cat <<-END_VERSIONS > versions.yml "${task.process}": - PretextMap: $VERSION + pretextmap: $VERSION samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//' ) END_VERSIONS """ stub: - def VERSION = "0.1.9" - def prefix = task.ext.prefix ?: "${meta.id}" + def VERSION = "0.1.9" + def prefix = task.ext.prefix ?: "${meta.id}" """ touch ${prefix}.pretext cat <<-END_VERSIONS > versions.yml "${task.process}": - PretextMap: $VERSION - samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//' )) + pretextmap: $VERSION + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') END_VERSIONS """ } diff --git a/modules/nf-core/pretextmap/meta.yml b/modules/nf-core/pretextmap/meta.yml index 47811974..d79295cd 100644 --- a/modules/nf-core/pretextmap/meta.yml +++ b/modules/nf-core/pretextmap/meta.yml @@ -6,38 +6,54 @@ keywords: - map tools: - "pretextmap": - description: "Paired REad TEXTure Mapper. Converts SAM formatted read pairs into genome contact maps." + description: "Paired REad TEXTure Mapper. Converts SAM formatted read pairs into + genome contact maps." homepage: "https://github.com/wtsi-hpag/PretextMap" documentation: "https://github.com/wtsi-hpag/PretextMap/blob/master/README.md" - - licence: "['MIT']" - + licence: ["MIT"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - input: - type: file - description: BAM/CRAM/SAM file or pairs formatted reads file - pattern: "*.{bam,cram,sam,pairs.gz}" - + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: BAM/CRAM/SAM file or pairs formatted reads file + pattern: "*.{bam,cram,sam,pairs.gz}" + - - meta2: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Reference sequence file + pattern: "*.{fasta,fna,fa}" + - fai: + type: file + description: Reference sequence index file + pattern: "*.{fai}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - pretext: - type: file - description: pretext map - pattern: "*.pretext" - + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.pretext": + type: file + description: pretext map + pattern: "*.pretext" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@marrip" - "@getrudeln" +maintainers: + - "@marrip" + - "@getrudeln" diff --git a/modules/nf-core/pretextmap/pretextmap.diff b/modules/nf-core/pretextmap/pretextmap.diff index 2494d6ce..7343eff2 100644 --- a/modules/nf-core/pretextmap/pretextmap.diff +++ b/modules/nf-core/pretextmap/pretextmap.diff @@ -1,64 +1,53 @@ Changes in module 'nf-core/pretextmap' +'modules/nf-core/pretextmap/meta.yml' is unchanged +Changes in 'pretextmap/main.nf': --- modules/nf-core/pretextmap/main.nf +++ modules/nf-core/pretextmap/main.nf -@@ -3,26 +3,24 @@ - tag "$meta.id" +@@ -4,9 +4,7 @@ label 'process_single' -- conda "bioconda::pretextmap=0.1.9 bioconda::samtools=1.17" + conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-f3591ce8609c7b3b33e5715333200aa5c163aa61%3A44321ab4d64f0b6d0c93abbd1406369d1b3da684-0': - 'biocontainers/mulled-v2-f3591ce8609c7b3b33e5715333200aa5c163aa61:44321ab4d64f0b6d0c93abbd1406369d1b3da684-0' }" -+ container "quay.io/sanger-tol/pretext:0.0.2-yy5-c3" ++ container "quay.io/sanger-tol/pretext:0.0.2-yy5-c4" input: -- tuple val(meta), path(input) -- path fasta -+ tuple val(meta), path(input) -+ tuple val(meta2), path(fasta), path(genome) - - output: - tuple val(meta), path("*.pretext"), emit: pretext -- path "versions.yml" , emit: versions -+ path "versions.yml", emit: versions - - when: + tuple val(meta), path(input) +@@ -20,6 +18,7 @@ task.ext.when == null || task.ext.when script: -- def args = task.ext.args ?: '' -- def prefix = task.ext.prefix ?: "${meta.id}" -- def reference = fasta ? "--reference ${fasta}" : "" -+ def VERSION = "0.1.9" -+ def args = task.ext.args ?: '' -+ def prefix = task.ext.prefix ?: "${meta.id}" -+ def reference = fasta ? "--reference ${fasta}" : "" - - """ - if [[ $input == *.pairs.gz ]]; then -@@ -41,19 +39,20 @@ ++ def VERSION = "0.1.9" + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def reference = fasta ? "--reference ${fasta}" : "" +@@ -41,19 +40,20 @@ cat <<-END_VERSIONS > versions.yml "${task.process}": - pretextmap: \$(PretextMap | grep "Version" | sed 's/PretextMap Version //g') -+ PretextMap: $VERSION ++ pretextmap: $VERSION samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//' ) END_VERSIONS """ stub: -- def prefix = task.ext.prefix ?: "${meta.id}" -+ def VERSION = "0.1.9" -+ def prefix = task.ext.prefix ?: "${meta.id}" ++ def VERSION = "0.1.9" + def prefix = task.ext.prefix ?: "${meta.id}" """ touch ${prefix}.pretext cat <<-END_VERSIONS > versions.yml "${task.process}": - pretextmap: \$(PretextMap | grep "Version" | sed 's/PretextMap Version //g') -+ PretextMap: $VERSION - samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//' )) ++ pretextmap: $VERSION + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') END_VERSIONS """ +'modules/nf-core/pretextmap/environment.yml' is unchanged +'modules/nf-core/pretextmap/tests/main.nf.test' is unchanged +'modules/nf-core/pretextmap/tests/tags.yml' is unchanged +'modules/nf-core/pretextmap/tests/main.nf.test.snap' is unchanged ************************************************************ diff --git a/modules/nf-core/pretextsnapshot/main.nf b/modules/nf-core/pretextsnapshot/main.nf index c896343c..39d72c74 100644 --- a/modules/nf-core/pretextsnapshot/main.nf +++ b/modules/nf-core/pretextsnapshot/main.nf @@ -2,7 +2,9 @@ process PRETEXTSNAPSHOT { tag "$meta.id" label 'process_single' - container "quay.io/sanger-tol/pretext:0.0.2-yy5-c3" + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : 'docker.io/ubuntu:20.04' }" input: tuple val(meta), path(pretext_map) @@ -15,10 +17,9 @@ process PRETEXTSNAPSHOT { task.ext.when == null || task.ext.when script: - def VERSION = "0.0.4" - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - + def VERSION = "0.0.4" + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}." """ PretextSnapshot \\ $args \\ @@ -29,7 +30,7 @@ process PRETEXTSNAPSHOT { cat <<-END_VERSIONS > versions.yml "${task.process}": - PretextSnapshot: $VERSION + pretextsnapshot: $VERSION END_VERSIONS """ @@ -40,7 +41,7 @@ process PRETEXTSNAPSHOT { cat <<-END_VERSIONS > versions.yml "${task.process}": - PretextSnapshot: $VERSION + pretextsnapshot: $VERSION END_VERSIONS """ } diff --git a/modules/nf-core/pretextsnapshot/meta.yml b/modules/nf-core/pretextsnapshot/meta.yml index fe9cb17a..434da68e 100644 --- a/modules/nf-core/pretextsnapshot/meta.yml +++ b/modules/nf-core/pretextsnapshot/meta.yml @@ -13,33 +13,35 @@ tools: description: "Commandline image generator for Pretext Hi-C genome contact maps." homepage: "https://github.com/wtsi-hpag/PretextSnapshot" tool_dev_url: "https://github.com/wtsi-hpag/PretextSnapshot" - licence: "['https://github.com/wtsi-hpag/PretextSnapshot/blob/master/LICENSE']" - + licence: ["https://github.com/wtsi-hpag/PretextSnapshot/blob/master/LICENSE"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - pretext_map: - type: file - description: pretext hic map - pattern: "*.pretext" - + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - pretext_map: + type: file + description: pretext hic map + pattern: "*.pretext" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - image: - type: file - description: image of a hic contact map - pattern: "*.{png,jpg,bmp}" - + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.{jpeg,png,bmp}": + type: file + description: image of a hic contact map + pattern: "*.{png,jpg,bmp}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@epaule" +maintainers: + - "@epaule" diff --git a/modules/nf-core/pretextsnapshot/pretextsnapshot.diff b/modules/nf-core/pretextsnapshot/pretextsnapshot.diff index caba07ac..edd414d5 100644 --- a/modules/nf-core/pretextsnapshot/pretextsnapshot.diff +++ b/modules/nf-core/pretextsnapshot/pretextsnapshot.diff @@ -1,33 +1,29 @@ Changes in module 'nf-core/pretextsnapshot' +'modules/nf-core/pretextsnapshot/meta.yml' is unchanged +Changes in 'pretextsnapshot/main.nf': --- modules/nf-core/pretextsnapshot/main.nf +++ modules/nf-core/pretextsnapshot/main.nf -@@ -2,11 +2,9 @@ - tag "$meta.id" - label 'process_single' +@@ -4,8 +4,7 @@ -- conda "bioconda::pretextsnapshot=0.0.4" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/pretextsnapshot:0.0.4--h7d875b9_0': - 'biocontainers/pretextsnapshot:0.0.4--h7d875b9_0' }" -- -+ 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : -+ 'docker.io/ubuntu:20.04' }" ++ 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : 'docker.io/ubuntu:20.04' }" + input: tuple val(meta), path(pretext_map) - -@@ -18,18 +16,32 @@ +@@ -18,18 +17,31 @@ task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' -- def prefix = task.ext.prefix ?: "${meta.id}" -+ def VERSION = "0.0.4" -+ def args = task.ext.args ?: '' -+ def prefix = task.ext.prefix ?: "${meta.id}" -+ def pretext_path = "${projectDir}/bin/PretextSnapshot/bin/PretextSnapshot" +- def prefix = task.ext.prefix ?: "${meta.id}." ++ def VERSION = "0.0.4" ++ def args = task.ext.args ?: '' ++ def prefix = task.ext.prefix ?: "${meta.id}." """ -- PretextSnapshot \\ -+ ${pretext_path} \\ + PretextSnapshot \\ $args \\ + --memory $task.memory \\ --map $pretext_map \\ @@ -53,4 +49,5 @@ Changes in module 'nf-core/pretextsnapshot' """ } +'modules/nf-core/pretextsnapshot/environment.yml' is unchanged ************************************************************ diff --git a/modules/nf-core/seqtk/cutn/environment.yml b/modules/nf-core/seqtk/cutn/environment.yml index a57afbb6..693aa5c1 100644 --- a/modules/nf-core/seqtk/cutn/environment.yml +++ b/modules/nf-core/seqtk/cutn/environment.yml @@ -1,7 +1,5 @@ -name: seqtk_cutn channels: - conda-forge - bioconda - - defaults dependencies: - bioconda::seqtk=1.4 diff --git a/modules/nf-core/seqtk/cutn/meta.yml b/modules/nf-core/seqtk/cutn/meta.yml index 10828679..2e39a477 100644 --- a/modules/nf-core/seqtk/cutn/meta.yml +++ b/modules/nf-core/seqtk/cutn/meta.yml @@ -6,35 +6,40 @@ keywords: - seqtk tools: - seqtk: - description: Seqtk is a fast and lightweight tool for processing sequences in the FASTA or FASTQ format. Seqtk mergepe command merges pair-end reads into one interleaved file. + description: Seqtk is a fast and lightweight tool for processing sequences in + the FASTA or FASTQ format. Seqtk mergepe command merges pair-end reads into + one interleaved file. homepage: https://github.com/lh3/seqtk documentation: https://docs.csc.fi/apps/seqtk/ tool_dev_url: https://github.com/lh3/seqtk licence: ["MIT"] + identifier: biotools:seqtk input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - fasta: - type: file - description: A single fasta file to be split. - pattern: "*.{fasta}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: A single fasta file to be split. + pattern: "*.{fasta}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - bed: - type: file - description: The output bed which summarised locations of cuts - pattern: "*.{bed}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bed": + type: file + description: The output bed which summarised locations of cuts + pattern: "*.{bed}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@DLBPointon" maintainers: diff --git a/modules/nf-core/tabix/bgziptabix/environment.yml b/modules/nf-core/tabix/bgziptabix/environment.yml index 028461c9..017c259d 100644 --- a/modules/nf-core/tabix/bgziptabix/environment.yml +++ b/modules/nf-core/tabix/bgziptabix/environment.yml @@ -1,7 +1,7 @@ -name: tabix_bgziptabix channels: - conda-forge - bioconda - - defaults + dependencies: + - bioconda::htslib=1.20 - bioconda::tabix=1.11 diff --git a/modules/nf-core/tabix/bgziptabix/main.nf b/modules/nf-core/tabix/bgziptabix/main.nf index f9482690..22f37a77 100644 --- a/modules/nf-core/tabix/bgziptabix/main.nf +++ b/modules/nf-core/tabix/bgziptabix/main.nf @@ -4,8 +4,8 @@ process TABIX_BGZIPTABIX { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/tabix:1.11--hdfd78af_0' : - 'biocontainers/tabix:1.11--hdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/htslib:1.20--h5efdd21_2' : + 'biocontainers/htslib:1.20--h5efdd21_2' }" input: tuple val(meta), path(input) @@ -24,7 +24,7 @@ process TABIX_BGZIPTABIX { def prefix = task.ext.prefix ?: "${meta.id}" """ bgzip --threads ${task.cpus} -c $args $input > ${prefix}.${input.getExtension()}.gz - tabix $args2 ${prefix}.${input.getExtension()}.gz + tabix --threads ${task.cpus} $args2 ${prefix}.${input.getExtension()}.gz cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -34,10 +34,11 @@ process TABIX_BGZIPTABIX { stub: def prefix = task.ext.prefix ?: "${meta.id}" + def args2 = task.ext.args2 ?: '' + def index = args2.contains("-C ") || args2.contains("--csi") ? "csi" : "tbi" """ - touch ${prefix}.${input.getExtension()}.gz - touch ${prefix}.${input.getExtension()}.gz.tbi - touch ${prefix}.${input.getExtension()}.gz.csi + echo "" | gzip > ${prefix}.${input.getExtension()}.gz + touch ${prefix}.${input.getExtension()}.gz.${index} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/tabix/bgziptabix/meta.yml b/modules/nf-core/tabix/bgziptabix/meta.yml index 438aba4d..806fbc12 100644 --- a/modules/nf-core/tabix/bgziptabix/meta.yml +++ b/modules/nf-core/tabix/bgziptabix/meta.yml @@ -13,38 +13,50 @@ tools: documentation: https://www.htslib.org/doc/tabix.1.html doi: 10.1093/bioinformatics/btq671 licence: ["MIT"] + identifier: biotools:tabix input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - tab: - type: file - description: TAB-delimited genome position file - pattern: "*.{bed,gff,sam,vcf}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - input: + type: file + description: Sorted tab-delimited genome file output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - gz: - type: file - description: Output compressed file - pattern: "*.{gz}" - - tbi: - type: file - description: tabix index file - pattern: "*.{gz.tbi}" - - csi: - type: file - description: tabix alternate index file - pattern: "*.{gz.csi}" + - gz_tbi: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.gz": + type: file + description: bgzipped tab-delimited genome file + pattern: "*.gz" + - "*.tbi": + type: file + description: tabix index file + pattern: "*.tbi" + - gz_csi: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.gz": + type: file + description: bgzipped tab-delimited genome file + pattern: "*.gz" + - "*.csi": + type: file + description: csi index file + pattern: "*.csi" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@maxulysse" - "@DLBPointon" diff --git a/modules/nf-core/ucsc/bedgraphtobigwig/environment.yml b/modules/nf-core/ucsc/bedgraphtobigwig/environment.yml index f91e216f..27868a44 100644 --- a/modules/nf-core/ucsc/bedgraphtobigwig/environment.yml +++ b/modules/nf-core/ucsc/bedgraphtobigwig/environment.yml @@ -1,7 +1,5 @@ -name: ucsc_bedgraphtobigwig channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::ucsc-bedgraphtobigwig=445 + - bioconda::ucsc-bedgraphtobigwig=469 diff --git a/modules/nf-core/ucsc/bedgraphtobigwig/main.nf b/modules/nf-core/ucsc/bedgraphtobigwig/main.nf index bff0b00a..81cdee95 100644 --- a/modules/nf-core/ucsc/bedgraphtobigwig/main.nf +++ b/modules/nf-core/ucsc/bedgraphtobigwig/main.nf @@ -5,8 +5,8 @@ process UCSC_BEDGRAPHTOBIGWIG { // WARN: Version information not provided by tool on CLI. Please update version string below when bumping container versions. conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ucsc-bedgraphtobigwig:445--h954228d_0' : - 'biocontainers/ucsc-bedgraphtobigwig:445--h954228d_0' }" + 'https://depot.galaxyproject.org/singularity/ucsc-bedgraphtobigwig:469--h9b8f530_0' : + 'biocontainers/ucsc-bedgraphtobigwig:469--h9b8f530_0' }" input: tuple val(meta), path(bedgraph) @@ -22,7 +22,7 @@ process UCSC_BEDGRAPHTOBIGWIG { script: def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" - def VERSION = '445' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. + def VERSION = '469' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. """ bedGraphToBigWig \\ $bedgraph \\ @@ -37,7 +37,7 @@ process UCSC_BEDGRAPHTOBIGWIG { stub: def prefix = task.ext.prefix ?: "${meta.id}" - def VERSION = '445' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. + def VERSION = '469' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. """ touch ${prefix}.bigWig diff --git a/modules/nf-core/ucsc/bedgraphtobigwig/meta.yml b/modules/nf-core/ucsc/bedgraphtobigwig/meta.yml index a60118ab..5d42cbde 100755 --- a/modules/nf-core/ucsc/bedgraphtobigwig/meta.yml +++ b/modules/nf-core/ucsc/bedgraphtobigwig/meta.yml @@ -12,34 +12,37 @@ tools: homepage: http://hgdownload.cse.ucsc.edu/admin/exe/ documentation: https://genome.ucsc.edu/goldenPath/help/bigWig.html licence: ["varies; see http://genome.ucsc.edu/license"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - bedgraph: - type: file - description: bedGraph file - pattern: "*.{bedGraph}" - - sizes: - type: file - description: chromosome sizes file - pattern: "*.{sizes}" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bedgraph: + type: file + description: bedGraph file + pattern: "*.{bedGraph}" + - - sizes: + type: file + description: chromosome sizes file + pattern: "*.{sizes}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - bigwig: - type: file - description: bigWig file - pattern: "*.{bigWig}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bigWig": + type: file + description: bigWig file + pattern: "*.{bigWig}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" maintainers: diff --git a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test index 6209ddaf..94a799ef 100644 --- a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test +++ b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test @@ -9,17 +9,14 @@ nextflow_process { tag "ucsc/bedgraphtobigwig" test("Should run without failures") { - when { - params { - outdir = "$outputDir" - } process { """ - input[0] = [ [ id:'test' ], // meta map - [ file(params.test_data['sarscov2']['illumina']['test_bedgraph'], checkIfExists: true) ] - ] - input[1] = file(params.test_data['sarscov2']['genome']['genome_sizes'], checkIfExists: true) + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bedgraph/test.bedgraph", checkIfExists: true) + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.sizes", checkIfExists: true)) """ } } @@ -30,7 +27,27 @@ nextflow_process { { assert snapshot(process.out).match() } ) } - } + test("stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bedgraph/test.bedgraph", checkIfExists: true) + ]) + input[1] = Channel.of(file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.sizes", checkIfExists: true)) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap index 6b0de0ff..7c731f65 100644 --- a/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap +++ b/modules/nf-core/ucsc/bedgraphtobigwig/tests/main.nf.test.snap @@ -1,4 +1,37 @@ { + "stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bigWig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,db26514184acfdf220bb2f061382cf8c" + ], + "bigwig": [ + [ + { + "id": "test" + }, + "test.bigWig:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,db26514184acfdf220bb2f061382cf8c" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T10:47:58.558813949" + }, "Should run without failures": { "content": [ { @@ -11,7 +44,7 @@ ] ], "1": [ - "versions.yml:md5,93b027527145a243903a3c687c3453b8" + "versions.yml:md5,db26514184acfdf220bb2f061382cf8c" ], "bigwig": [ [ @@ -22,10 +55,14 @@ ] ], "versions": [ - "versions.yml:md5,93b027527145a243903a3c687c3453b8" + "versions.yml:md5,db26514184acfdf220bb2f061382cf8c" ] } ], - "timestamp": "2023-10-18T04:06:47.826602" + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-18T10:47:36.476844229" } } \ No newline at end of file diff --git a/modules/nf-core/ucsc/bedtobigbed/main.nf b/modules/nf-core/ucsc/bedtobigbed/main.nf index 1e40375d..9902560f 100644 --- a/modules/nf-core/ucsc/bedtobigbed/main.nf +++ b/modules/nf-core/ucsc/bedtobigbed/main.nf @@ -3,10 +3,10 @@ process UCSC_BEDTOBIGBED { label 'process_single' // WARN: Version information not provided by tool on CLI. Please update version string below when bumping container versions. - conda "bioconda::ucsc-bedtobigbed=377" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ucsc-bedtobigbed:377--ha8a8165_3' : - 'biocontainers/ucsc-bedtobigbed:377--ha8a8165_3' }" + 'https://depot.galaxyproject.org/singularity/ucsc-bedtobigbed:447--h954228d_0' : + 'biocontainers/ucsc-bedtobigbed:447--h954228d_0' }" input: tuple val(meta), path(bed) @@ -24,7 +24,7 @@ process UCSC_BEDTOBIGBED { def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" def as_option = autosql ? "-as=${autosql}" : "" - def VERSION = '377' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. + def VERSION = '447' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. """ bedToBigBed \\ $bed \\ @@ -41,7 +41,7 @@ process UCSC_BEDTOBIGBED { stub: def prefix = task.ext.prefix ?: "${meta.id}" - def VERSION = '377' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. + def VERSION = '447' // WARN: Version information not provided by tool on CLI. Please update this string when bumping container versions. """ touch ${prefix}.bigBed diff --git a/modules/nf-core/ucsc/bedtobigbed/meta.yml b/modules/nf-core/ucsc/bedtobigbed/meta.yml index 8e9e5291..6afc3148 100755 --- a/modules/nf-core/ucsc/bedtobigbed/meta.yml +++ b/modules/nf-core/ucsc/bedtobigbed/meta.yml @@ -12,40 +12,42 @@ tools: homepage: http://hgdownload.cse.ucsc.edu/admin/exe/ documentation: https://genome.ucsc.edu/goldenPath/help/bigBed.html licence: ["varies; see http://genome.ucsc.edu/license"] - + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - bed: - type: file - description: bed file - pattern: "*.{bed}" - - sizes: - type: file - description: chromosome sizes file - pattern: "*.{sizes}" - - autosql: - type: file - description: autoSql file to describe the columns of the BED file - pattern: "*.{as}" - + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - bed: + type: file + description: bed file + pattern: "*.{bed}" + - - sizes: + type: file + description: chromosome sizes file + pattern: "*.{sizes}" + - - autosql: + type: file + description: autoSql file to describe the columns of the BED file + pattern: "*.{as}" output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - bigbed: - type: file - description: bigBed file - pattern: "*.{bigBed}" - + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.bigBed": + type: file + description: bigBed file + pattern: "*.{bigBed}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" +maintainers: + - "@drpatelh" diff --git a/modules/nf-core/windowmasker/mkcounts/environment.yml b/modules/nf-core/windowmasker/mkcounts/environment.yml index 15887425..777e097e 100644 --- a/modules/nf-core/windowmasker/mkcounts/environment.yml +++ b/modules/nf-core/windowmasker/mkcounts/environment.yml @@ -1,7 +1,5 @@ -name: windowmasker_mkcounts channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::blast=2.14.0 + - bioconda::blast=2.15.0 diff --git a/modules/nf-core/windowmasker/mkcounts/main.nf b/modules/nf-core/windowmasker/mkcounts/main.nf index 6bfd175e..406f7761 100644 --- a/modules/nf-core/windowmasker/mkcounts/main.nf +++ b/modules/nf-core/windowmasker/mkcounts/main.nf @@ -4,8 +4,8 @@ process WINDOWMASKER_MKCOUNTS { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/blast:2.14.0--h7d5a4b4_1': - 'biocontainers/blast:2.14.0--h7d5a4b4_1' }" + 'https://depot.galaxyproject.org/singularity/blast:2.15.0--pl5321h6f7f691_1': + 'biocontainers/blast:2.15.0--pl5321h6f7f691_1' }" input: tuple val(meta), path(ref) @@ -21,11 +21,11 @@ process WINDOWMASKER_MKCOUNTS { def args = task.ext.args ?: "" def prefix = task.ext.prefix ?: "${meta.id}" - def memory = 3072 + def memory = 3072 if (!task.memory) { log.info '[WINDOWMASKER: MK_COUNTS] Available memory not known - defaulting to 3GB. Specify process memory requirements to change this.' } else { - memory = (task.memory.toMega()).intValue() + memory = (task.memory.toMega()).intValue() } """ diff --git a/modules/nf-core/windowmasker/mkcounts/meta.yml b/modules/nf-core/windowmasker/mkcounts/meta.yml index 436ed7a5..825a0674 100644 --- a/modules/nf-core/windowmasker/mkcounts/meta.yml +++ b/modules/nf-core/windowmasker/mkcounts/meta.yml @@ -11,31 +11,32 @@ tools: homepage: https://github.com/ncbi/ncbi-cxx-toolkit-public documentation: https://ncbi.github.io/cxx-toolkit/ licence: ["MIT"] + identifier: biotools:windowmasker input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - ref: - type: file - description: An input nucleotide fasta file. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ref: + type: file + description: An input nucleotide fasta file. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - intervals: - type: file - description: | - An output file containing genomic locations of low - complexity and highly repetitive regions - pattern: "${prefix}.txt" + - counts: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.txt": + type: file + description: A file containing frequency counts of repetitive units. + pattern: "*.txt" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@DLBPointon" maintainers: diff --git a/modules/nf-core/windowmasker/ustat/environment.yml b/modules/nf-core/windowmasker/ustat/environment.yml index a97fdd9d..777e097e 100644 --- a/modules/nf-core/windowmasker/ustat/environment.yml +++ b/modules/nf-core/windowmasker/ustat/environment.yml @@ -1,7 +1,5 @@ -name: windowmasker_ustat channels: - conda-forge - bioconda - - defaults dependencies: - - bioconda::blast=2.14.0 + - bioconda::blast=2.15.0 diff --git a/modules/nf-core/windowmasker/ustat/main.nf b/modules/nf-core/windowmasker/ustat/main.nf index 2cc3df63..7a7d29f6 100644 --- a/modules/nf-core/windowmasker/ustat/main.nf +++ b/modules/nf-core/windowmasker/ustat/main.nf @@ -4,8 +4,8 @@ process WINDOWMASKER_USTAT { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/blast:2.14.0--h7d5a4b4_1': - 'biocontainers/blast:2.14.0--h7d5a4b4_1' }" + 'https://depot.galaxyproject.org/singularity/blast:2.15.0--pl5321h6f7f691_1': + 'biocontainers/blast:2.15.0--pl5321h6f7f691_1' }" input: tuple val(meta) , path(counts) diff --git a/modules/nf-core/windowmasker/ustat/meta.yml b/modules/nf-core/windowmasker/ustat/meta.yml index 6a07c935..bc51a934 100644 --- a/modules/nf-core/windowmasker/ustat/meta.yml +++ b/modules/nf-core/windowmasker/ustat/meta.yml @@ -1,5 +1,6 @@ name: windowmasker_ustat -description: A program to take a counts file and creates a file of genomic co-ordinates to be masked. +description: A program to take a counts file and creates a file of genomic co-ordinates + to be masked. keywords: - fasta - interval @@ -11,39 +12,39 @@ tools: homepage: https://github.com/ncbi/ncbi-cxx-toolkit-public documentation: https://ncbi.github.io/cxx-toolkit/ licence: ["MIT"] + identifier: biotools:windowmasker input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test' ] - - counts: - type: file - description: Contains count data of repetitive regions. - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - ref: - type: file - description: An input nucleotide fasta file. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test' ] + - counts: + type: file + description: Contains count data of repetitive regions. + - - meta2: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ref: + type: file + description: An input nucleotide fasta file. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - wm_intervals: - type: file - description: | - An output file containing genomic locations of low - complexity and highly repetitive regions - pattern: "${output}" + - intervals: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - ${output}: + type: file + description: intervals - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@DLBPointon" maintainers: diff --git a/subworkflows/local/busco_annotation.nf b/subworkflows/local/busco_annotation.nf index 40c85166..75182788 100755 --- a/subworkflows/local/busco_annotation.nf +++ b/subworkflows/local/busco_annotation.nf @@ -8,7 +8,7 @@ // // MODULE IMPORT BLOCK // -include { BUSCO } from '../../modules/nf-core/busco/main' +include { BUSCO_BUSCO } from '../../modules/nf-core/busco/busco/main' include { UCSC_BEDTOBIGBED } from '../../modules/nf-core/ucsc/bedtobigbed/main' include { BEDTOOLS_SORT } from '../../modules/nf-core/bedtools/sort/main' include { EXTRACT_BUSCOGENE } from '../../modules/local/extract_buscogene' @@ -38,16 +38,16 @@ workflow BUSCO_ANNOTATION { // MODULE: RUN BUSCO TO OBTAIN FULL_TABLE.CSV // EMITS FULL_TABLE.CSV // - BUSCO ( + BUSCO_BUSCO ( reference_tuple, ch_busco_mode, lineageinfo, lineagespath, [] ) - ch_versions = ch_versions.mix(BUSCO.out.versions.first()) + ch_versions = ch_versions.mix(BUSCO_BUSCO.out.versions.first()) - ch_grab = GrabFiles(BUSCO.out.busco_dir) + ch_grab = GrabFiles(BUSCO_BUSCO.out.busco_dir) // // MODULE: EXTRACT THE BUSCO GENES FOUND IN REFERENCE @@ -92,7 +92,7 @@ workflow BUSCO_ANNOTATION { // LOGIC: AGGREGATE DATA AND SORT BRANCH ON CLASS // lineageinfo - .combine(BUSCO.out.busco_dir) + .combine(BUSCO_BUSCO.out.busco_dir) .combine(ancestral_table) .branch { lep: it[0].split('_')[0] == "lepidoptera" From e93fd9a5cc7a00f22ecd055f369e188db8434883 Mon Sep 17 00:00:00 2001 From: DLBPointon Date: Wed, 20 Nov 2024 14:38:41 +0000 Subject: [PATCH 02/10] Updating all easy to update modules --- .../bedtools/intersect/tests/main.nf.test | 90 +++ .../intersect/tests/main.nf.test.snap | 101 +++ .../bedtools/intersect/tests/nextflow.config | 5 + .../nf-core/bedtools/intersect/tests/tags.yml | 2 + .../bedtools/makewindows/tests/main.nf.test | 58 ++ .../makewindows/tests/main.nf.test.snap | 68 ++ .../makewindows/tests/nextflow.config | 5 + .../nf-core/bedtools/merge/tests/main.nf.test | 34 + .../bedtools/merge/tests/main.nf.test.snap | 35 + .../bedtools/merge/tests/nextflow.config | 7 + modules/nf-core/bedtools/merge/tests/tags.yml | 2 + .../nf-core/bedtools/sort/tests/main.nf.test | 58 ++ .../bedtools/sort/tests/main.nf.test.snap | 68 ++ .../bedtools/sort/tests/nextflow.config | 8 + modules/nf-core/bedtools/sort/tests/tags.yml | 2 + .../nf-core/busco/busco/tests/main.nf.test | 415 ++++++++++++ .../busco/busco/tests/main.nf.test.snap | 230 +++++++ .../busco/tests/nextflow.augustus.config | 5 + .../nf-core/busco/busco/tests/nextflow.config | 5 + .../busco/busco/tests/nextflow.metaeuk.config | 5 + .../nf-core/busco/busco/tests/old_test.yml | 624 ++++++++++++++++++ modules/nf-core/busco/busco/tests/tags.yml | 2 + .../nf-core/bwamem2/index/tests/main.nf.test | 31 + .../bwamem2/index/tests/main.nf.test.snap | 47 ++ modules/nf-core/bwamem2/index/tests/tags.yml | 2 + modules/nf-core/gnu/sort/tests/main.nf.test | 120 ++++ .../nf-core/gnu/sort/tests/main.nf.test.snap | 164 +++++ .../gnu/sort/tests/sort_complex.config | 6 + .../gnu/sort/tests/sort_simple_bed.config | 6 + .../gnu/sort/tests/sort_simple_genome.config | 6 + modules/nf-core/gnu/sort/tests/tags.yml | 2 + .../nf-core/minimap2/index/tests/main.nf.test | 32 + .../minimap2/index/tests/main.nf.test.snap | 68 ++ modules/nf-core/minimap2/index/tests/tags.yml | 2 + .../nf-core/miniprot/align/tests/main.nf.test | 89 +++ .../miniprot/align/tests/main.nf.test.snap | 119 ++++ .../miniprot/align/tests/nextflow.gff.config | 5 + .../miniprot/align/tests/nextflow.paf.config | 5 + .../nf-core/miniprot/index/tests/main.nf.test | 51 ++ .../miniprot/index/tests/main.nf.test.snap | 68 ++ .../paftools/sam2paf/tests/main.nf.test | 57 ++ .../paftools/sam2paf/tests/main.nf.test.snap | 68 ++ .../nf-core/samtools/faidx/tests/main.nf.test | 122 ++++ .../samtools/faidx/tests/main.nf.test.snap | 249 +++++++ .../samtools/faidx/tests/nextflow.config | 7 + .../samtools/faidx/tests/nextflow2.config | 6 + modules/nf-core/samtools/faidx/tests/tags.yml | 2 + .../samtools/markdup/tests/main.nf.test | 90 +++ .../samtools/markdup/tests/main.nf.test.snap | 96 +++ .../samtools/markdup/tests/nextflow.config | 14 + .../samtools/sort/tests/nextflow_cram.config | 8 + modules/nf-core/seqtk/cutn/tests/main.nf.test | 57 ++ .../seqtk/cutn/tests/main.nf.test.snap | 70 ++ modules/nf-core/seqtk/cutn/tests/tags.yml | 2 + .../tabix/bgziptabix/tests/main.nf.test | 123 ++++ .../tabix/bgziptabix/tests/main.nf.test.snap | 206 ++++++ .../tabix/bgziptabix/tests/tabix_csi.config | 5 + .../tabix/bgziptabix/tests/tabix_tbi.config | 5 + .../nf-core/tabix/bgziptabix/tests/tags.yml | 2 + .../windowmasker/mkcounts/tests/main.nf.test | 59 ++ .../mkcounts/tests/main.nf.test.snap | 60 ++ .../mkcounts/tests/nextflow.config | 5 + .../windowmasker/mkcounts/tests/tags.yml | 2 + .../windowmasker/ustat/tests/main.nf.test | 66 ++ .../ustat/tests/main.nf.test.snap | 60 ++ .../windowmasker/ustat/tests/nextflow.config | 5 + .../nf-core/windowmasker/ustat/tests/tags.yml | 2 + 67 files changed, 4100 insertions(+) create mode 100644 modules/nf-core/bedtools/intersect/tests/main.nf.test create mode 100644 modules/nf-core/bedtools/intersect/tests/main.nf.test.snap create mode 100644 modules/nf-core/bedtools/intersect/tests/nextflow.config create mode 100644 modules/nf-core/bedtools/intersect/tests/tags.yml create mode 100644 modules/nf-core/bedtools/makewindows/tests/main.nf.test create mode 100644 modules/nf-core/bedtools/makewindows/tests/main.nf.test.snap create mode 100644 modules/nf-core/bedtools/makewindows/tests/nextflow.config create mode 100644 modules/nf-core/bedtools/merge/tests/main.nf.test create mode 100644 modules/nf-core/bedtools/merge/tests/main.nf.test.snap create mode 100644 modules/nf-core/bedtools/merge/tests/nextflow.config create mode 100644 modules/nf-core/bedtools/merge/tests/tags.yml create mode 100644 modules/nf-core/bedtools/sort/tests/main.nf.test create mode 100644 modules/nf-core/bedtools/sort/tests/main.nf.test.snap create mode 100644 modules/nf-core/bedtools/sort/tests/nextflow.config create mode 100644 modules/nf-core/bedtools/sort/tests/tags.yml create mode 100644 modules/nf-core/busco/busco/tests/main.nf.test create mode 100644 modules/nf-core/busco/busco/tests/main.nf.test.snap create mode 100644 modules/nf-core/busco/busco/tests/nextflow.augustus.config create mode 100644 modules/nf-core/busco/busco/tests/nextflow.config create mode 100644 modules/nf-core/busco/busco/tests/nextflow.metaeuk.config create mode 100644 modules/nf-core/busco/busco/tests/old_test.yml create mode 100644 modules/nf-core/busco/busco/tests/tags.yml create mode 100644 modules/nf-core/bwamem2/index/tests/main.nf.test create mode 100644 modules/nf-core/bwamem2/index/tests/main.nf.test.snap create mode 100644 modules/nf-core/bwamem2/index/tests/tags.yml create mode 100644 modules/nf-core/gnu/sort/tests/main.nf.test create mode 100644 modules/nf-core/gnu/sort/tests/main.nf.test.snap create mode 100644 modules/nf-core/gnu/sort/tests/sort_complex.config create mode 100644 modules/nf-core/gnu/sort/tests/sort_simple_bed.config create mode 100644 modules/nf-core/gnu/sort/tests/sort_simple_genome.config create mode 100644 modules/nf-core/gnu/sort/tests/tags.yml create mode 100644 modules/nf-core/minimap2/index/tests/main.nf.test create mode 100644 modules/nf-core/minimap2/index/tests/main.nf.test.snap create mode 100644 modules/nf-core/minimap2/index/tests/tags.yml create mode 100644 modules/nf-core/miniprot/align/tests/main.nf.test create mode 100644 modules/nf-core/miniprot/align/tests/main.nf.test.snap create mode 100644 modules/nf-core/miniprot/align/tests/nextflow.gff.config create mode 100644 modules/nf-core/miniprot/align/tests/nextflow.paf.config create mode 100644 modules/nf-core/miniprot/index/tests/main.nf.test create mode 100644 modules/nf-core/miniprot/index/tests/main.nf.test.snap create mode 100644 modules/nf-core/paftools/sam2paf/tests/main.nf.test create mode 100644 modules/nf-core/paftools/sam2paf/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/faidx/tests/main.nf.test create mode 100644 modules/nf-core/samtools/faidx/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/faidx/tests/nextflow.config create mode 100644 modules/nf-core/samtools/faidx/tests/nextflow2.config create mode 100644 modules/nf-core/samtools/faidx/tests/tags.yml create mode 100644 modules/nf-core/samtools/markdup/tests/main.nf.test create mode 100644 modules/nf-core/samtools/markdup/tests/main.nf.test.snap create mode 100644 modules/nf-core/samtools/markdup/tests/nextflow.config create mode 100644 modules/nf-core/samtools/sort/tests/nextflow_cram.config create mode 100644 modules/nf-core/seqtk/cutn/tests/main.nf.test create mode 100644 modules/nf-core/seqtk/cutn/tests/main.nf.test.snap create mode 100644 modules/nf-core/seqtk/cutn/tests/tags.yml create mode 100644 modules/nf-core/tabix/bgziptabix/tests/main.nf.test create mode 100644 modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap create mode 100644 modules/nf-core/tabix/bgziptabix/tests/tabix_csi.config create mode 100644 modules/nf-core/tabix/bgziptabix/tests/tabix_tbi.config create mode 100644 modules/nf-core/tabix/bgziptabix/tests/tags.yml create mode 100644 modules/nf-core/windowmasker/mkcounts/tests/main.nf.test create mode 100644 modules/nf-core/windowmasker/mkcounts/tests/main.nf.test.snap create mode 100644 modules/nf-core/windowmasker/mkcounts/tests/nextflow.config create mode 100644 modules/nf-core/windowmasker/mkcounts/tests/tags.yml create mode 100644 modules/nf-core/windowmasker/ustat/tests/main.nf.test create mode 100644 modules/nf-core/windowmasker/ustat/tests/main.nf.test.snap create mode 100644 modules/nf-core/windowmasker/ustat/tests/nextflow.config create mode 100644 modules/nf-core/windowmasker/ustat/tests/tags.yml diff --git a/modules/nf-core/bedtools/intersect/tests/main.nf.test b/modules/nf-core/bedtools/intersect/tests/main.nf.test new file mode 100644 index 00000000..cd770946 --- /dev/null +++ b/modules/nf-core/bedtools/intersect/tests/main.nf.test @@ -0,0 +1,90 @@ +nextflow_process { + + name "Test Process BEDTOOLS_INTERSECT" + script "../main.nf" + process "BEDTOOLS_INTERSECT" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "bedtools" + tag "bedtools/intersect" + + test("sarscov2 - bed - bed") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test2.bed', checkIfExists: true) + ] + + input[1] = [[:], []] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam - bam") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/baits.bed', checkIfExists: true) + ] + + input[1] = [[:], []] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bed - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test2.bed', checkIfExists: true) + ] + + input[1] = [[:], []] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bedtools/intersect/tests/main.nf.test.snap b/modules/nf-core/bedtools/intersect/tests/main.nf.test.snap new file mode 100644 index 00000000..b748dd49 --- /dev/null +++ b/modules/nf-core/bedtools/intersect/tests/main.nf.test.snap @@ -0,0 +1,101 @@ +{ + "sarscov2 - bam - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.bam:md5,738324efe2b1e442ceb6539a630c3fe6" + ] + ], + "1": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ], + "intersect": [ + [ + { + "id": "test" + }, + "test_out.bam:md5,738324efe2b1e442ceb6539a630c3fe6" + ] + ], + "versions": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-17T20:55:57.454847668" + }, + "sarscov2 - bed - bed": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.bed:md5,afcbf01c2f2013aad71dbe8e34f2c15c" + ] + ], + "1": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ], + "intersect": [ + [ + { + "id": "test" + }, + "test_out.bed:md5,afcbf01c2f2013aad71dbe8e34f2c15c" + ] + ], + "versions": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-17T20:55:49.072132931" + }, + "sarscov2 - bed - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ], + "intersect": [ + [ + { + "id": "test" + }, + "test_out.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,42ba439339672f4a9193f0f0fe7a7f64" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-17T20:56:06.259192552" + } +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/intersect/tests/nextflow.config b/modules/nf-core/bedtools/intersect/tests/nextflow.config new file mode 100644 index 00000000..f1f9e693 --- /dev/null +++ b/modules/nf-core/bedtools/intersect/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: BEDTOOLS_INTERSECT { + ext.prefix = { "${meta.id}_out" } + } +} diff --git a/modules/nf-core/bedtools/intersect/tests/tags.yml b/modules/nf-core/bedtools/intersect/tests/tags.yml new file mode 100644 index 00000000..6219cc40 --- /dev/null +++ b/modules/nf-core/bedtools/intersect/tests/tags.yml @@ -0,0 +1,2 @@ +bedtools/intersect: + - "modules/nf-core/bedtools/intersect/**" diff --git a/modules/nf-core/bedtools/makewindows/tests/main.nf.test b/modules/nf-core/bedtools/makewindows/tests/main.nf.test new file mode 100644 index 00000000..b27e59b6 --- /dev/null +++ b/modules/nf-core/bedtools/makewindows/tests/main.nf.test @@ -0,0 +1,58 @@ + +nextflow_process { + + name "Test Process BEDTOOLS_MAKEWINDOWS" + script "../main.nf" + process "BEDTOOLS_MAKEWINDOWS" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "bedtools" + tag "bedtools/makewindows" + + test("test-bedtools-makewindows-bed") { + + when { + process { + """ + input[0] = [ + [ id:'test2'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test-bedtools-makewindows-fai") { + + when { + process { + """ + input[0] = [ + [ id:'test2'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/bedtools/makewindows/tests/main.nf.test.snap b/modules/nf-core/bedtools/makewindows/tests/main.nf.test.snap new file mode 100644 index 00000000..22cfbc17 --- /dev/null +++ b/modules/nf-core/bedtools/makewindows/tests/main.nf.test.snap @@ -0,0 +1,68 @@ +{ + "test-bedtools-makewindows-fai": { + "content": [ + { + "0": [ + [ + { + "id": "test2" + }, + "test2.bed:md5,622d1f62786fe4239b76c53168f21c54" + ] + ], + "1": [ + "versions.yml:md5,f797078cc8b8bac7e6906685d4867be5" + ], + "bed": [ + [ + { + "id": "test2" + }, + "test2.bed:md5,622d1f62786fe4239b76c53168f21c54" + ] + ], + "versions": [ + "versions.yml:md5,f797078cc8b8bac7e6906685d4867be5" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-26T14:03:31.430455" + }, + "test-bedtools-makewindows-bed": { + "content": [ + { + "0": [ + [ + { + "id": "test2" + }, + "test2.bed:md5,0cf6ed2b6f470cd44a247da74ca4fe4e" + ] + ], + "1": [ + "versions.yml:md5,f797078cc8b8bac7e6906685d4867be5" + ], + "bed": [ + [ + { + "id": "test2" + }, + "test2.bed:md5,0cf6ed2b6f470cd44a247da74ca4fe4e" + ] + ], + "versions": [ + "versions.yml:md5,f797078cc8b8bac7e6906685d4867be5" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-26T14:03:27.118372" + } +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/makewindows/tests/nextflow.config b/modules/nf-core/bedtools/makewindows/tests/nextflow.config new file mode 100644 index 00000000..fa16733f --- /dev/null +++ b/modules/nf-core/bedtools/makewindows/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: BEDTOOLS_MAKEWINDOWS { + ext.args = '-w 50 ' + } +} diff --git a/modules/nf-core/bedtools/merge/tests/main.nf.test b/modules/nf-core/bedtools/merge/tests/main.nf.test new file mode 100644 index 00000000..2959d6b9 --- /dev/null +++ b/modules/nf-core/bedtools/merge/tests/main.nf.test @@ -0,0 +1,34 @@ +nextflow_process { + + name "Test Process BEDTOOLS_MERGE" + script "../main.nf" + config "./nextflow.config" + process "BEDTOOLS_MERGE" + + tag "modules" + tag "modules_nfcore" + tag "bedtools" + tag "bedtools/merge" + + test("test_bedtools_merge") { + + when { + process { + """ + input[0] = [ [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/merge/tests/main.nf.test.snap b/modules/nf-core/bedtools/merge/tests/main.nf.test.snap new file mode 100644 index 00000000..ee6c4e63 --- /dev/null +++ b/modules/nf-core/bedtools/merge/tests/main.nf.test.snap @@ -0,0 +1,35 @@ +{ + "test_bedtools_merge": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.bed:md5,0cf6ed2b6f470cd44a247da74ca4fe4e" + ] + ], + "1": [ + "versions.yml:md5,2d134badb4cd1e4e903696c7967f28d6" + ], + "bed": [ + [ + { + "id": "test" + }, + "test_out.bed:md5,0cf6ed2b6f470cd44a247da74ca4fe4e" + ] + ], + "versions": [ + "versions.yml:md5,2d134badb4cd1e4e903696c7967f28d6" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T17:07:09.721153" + } +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/merge/tests/nextflow.config b/modules/nf-core/bedtools/merge/tests/nextflow.config new file mode 100644 index 00000000..16444e98 --- /dev/null +++ b/modules/nf-core/bedtools/merge/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: BEDTOOLS_MERGE { + ext.prefix = { "${meta.id}_out" } + } + +} diff --git a/modules/nf-core/bedtools/merge/tests/tags.yml b/modules/nf-core/bedtools/merge/tests/tags.yml new file mode 100644 index 00000000..60c8cad1 --- /dev/null +++ b/modules/nf-core/bedtools/merge/tests/tags.yml @@ -0,0 +1,2 @@ +bedtools/merge: + - "modules/nf-core/bedtools/merge/**" diff --git a/modules/nf-core/bedtools/sort/tests/main.nf.test b/modules/nf-core/bedtools/sort/tests/main.nf.test new file mode 100644 index 00000000..b1f36dd9 --- /dev/null +++ b/modules/nf-core/bedtools/sort/tests/main.nf.test @@ -0,0 +1,58 @@ +nextflow_process { + + name "Test Process BEDTOOLS_SORT" + script "../main.nf" + config "./nextflow.config" + process "BEDTOOLS_SORT" + + tag "modules" + tag "modules_nfcore" + tag "bedtools" + tag "bedtools/sort" + + test("test_bedtools_sort") { + + when { + process { + """ + input[0] = [ [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) + ] + input[1] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + + test("test_bedtools_sort_with_genome") { + + when { + process { + """ + input[0] = [ [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) + ] + input[1] = file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/sort/tests/main.nf.test.snap b/modules/nf-core/bedtools/sort/tests/main.nf.test.snap new file mode 100644 index 00000000..f10e8b98 --- /dev/null +++ b/modules/nf-core/bedtools/sort/tests/main.nf.test.snap @@ -0,0 +1,68 @@ +{ + "test_bedtools_sort_with_genome": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.testtext:md5,fe4053cf4de3aebbdfc3be2efb125a74" + ] + ], + "1": [ + "versions.yml:md5,cdbae2c7ebc41e534aaf0835779061f8" + ], + "sorted": [ + [ + { + "id": "test" + }, + "test_out.testtext:md5,fe4053cf4de3aebbdfc3be2efb125a74" + ] + ], + "versions": [ + "versions.yml:md5,cdbae2c7ebc41e534aaf0835779061f8" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-19T10:13:11.830452" + }, + "test_bedtools_sort": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test_out.testtext:md5,fe4053cf4de3aebbdfc3be2efb125a74" + ] + ], + "1": [ + "versions.yml:md5,cdbae2c7ebc41e534aaf0835779061f8" + ], + "sorted": [ + [ + { + "id": "test" + }, + "test_out.testtext:md5,fe4053cf4de3aebbdfc3be2efb125a74" + ] + ], + "versions": [ + "versions.yml:md5,cdbae2c7ebc41e534aaf0835779061f8" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-19T10:16:40.535947" + } +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/sort/tests/nextflow.config b/modules/nf-core/bedtools/sort/tests/nextflow.config new file mode 100644 index 00000000..f203c99c --- /dev/null +++ b/modules/nf-core/bedtools/sort/tests/nextflow.config @@ -0,0 +1,8 @@ +process { + + withName: BEDTOOLS_SORT { + ext.prefix = { "${meta.id}_out" } + ext.suffix = "testtext" + } + +} \ No newline at end of file diff --git a/modules/nf-core/bedtools/sort/tests/tags.yml b/modules/nf-core/bedtools/sort/tests/tags.yml new file mode 100644 index 00000000..47c85eea --- /dev/null +++ b/modules/nf-core/bedtools/sort/tests/tags.yml @@ -0,0 +1,2 @@ +bedtools/sort: + - "modules/nf-core/bedtools/sort/**" diff --git a/modules/nf-core/busco/busco/tests/main.nf.test b/modules/nf-core/busco/busco/tests/main.nf.test new file mode 100644 index 00000000..bb7b49a9 --- /dev/null +++ b/modules/nf-core/busco/busco/tests/main.nf.test @@ -0,0 +1,415 @@ +nextflow_process { + + name "Test Process BUSCO_BUSCO" + script "../main.nf" + process "BUSCO_BUSCO" + + tag "modules" + tag "modules_nfcore" + tag "busco" + tag "busco/busco" + + test("test_busco_genome_single_fasta") { + + config './nextflow.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true) + ] + input[1] = 'genome' + input[2] = 'bacteria_odb10' // Launch with 'auto' to use --auto-lineage, and specified lineages // 'auto' removed from test due to memory issues + input[3] = [] // Download busco lineage + input[4] = [] // No config + """ + } + } + + then { + assert process.success + + with(path(process.out.short_summaries_txt[0][1]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_json[0][1]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + assert snapshot( + process.out.batch_summary[0][1], + process.out.full_table[0][1], + process.out.missing_busco_list[0][1], + process.out.versions[0] + ).match() + + with(file(process.out.seq_dir[0][1]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Results from dataset') + assert contains('how to cite BUSCO') + } + + assert process.out.single_copy_proteins == [] + assert process.out.translated_dir == [] + } + } + + test("test_busco_genome_multi_fasta") { + + config './nextflow.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/prokaryotes/candidatus_portiera_aleyrodidarum/genome/genome.fasta', checkIfExists: true) + ] + ] + input[1] = 'genome' + input[2] = 'bacteria_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assert process.success + + with(path(process.out.short_summaries_txt[0][1][0]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_txt[0][1][1]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_json[0][1][0]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + with(path(process.out.short_summaries_json[0][1][1]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + assert snapshot( + process.out.batch_summary[0][1], + process.out.full_table[0][1], + process.out.missing_busco_list[0][1], + process.out.versions[0] + ).match() + + with(file(process.out.seq_dir[0][1][0]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(file(process.out.seq_dir[0][1][1]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Results from dataset') + assert contains('how to cite BUSCO') + } + + assert process.out.single_copy_proteins == [] + assert process.out.translated_dir == [] + } + + } + + test("test_busco_eukaryote_metaeuk") { + + config './nextflow.metaeuk.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ] + input[1] = 'genome' + input[2] = 'eukaryota_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assert process.success + + with(path(process.out.short_summaries_txt[0][1]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_json[0][1]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + assert snapshot( + process.out.batch_summary[0][1], + process.out.full_table[0][1], + process.out.missing_busco_list[0][1], + process.out.versions[0] + ).match() + + with(file(process.out.seq_dir[0][1]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Results from dataset') + assert contains('how to cite BUSCO') + + } + + assert process.out.single_copy_proteins == [] + assert process.out.translated_dir == [] + } + + } + + test("test_busco_eukaryote_augustus") { + + config './nextflow.augustus.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ] + input[1] = 'genome' + input[2] = 'eukaryota_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assert process.success + + assert snapshot( + process.out.batch_summary[0][1], + process.out.versions[0] + ).match() + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Augustus did not recognize any genes') + + } + + assert process.out.short_summaries_json == [] + assert process.out.short_summaries_txt == [] + assert process.out.missing_busco_list == [] + assert process.out.full_table == [] + assert process.out.single_copy_proteins == [] + assert process.out.translated_dir == [] + } + + } + + test("test_busco_protein") { + + config './nextflow.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/prokaryotes/candidatus_portiera_aleyrodidarum/genome/proteome.fasta', checkIfExists: true) + ] + input[1] = 'proteins' + input[2] = 'bacteria_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assert process.success + + with(path(process.out.short_summaries_txt[0][1]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_json[0][1]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + assert snapshot( + process.out.batch_summary[0][1], + process.out.full_table[0][1], + process.out.missing_busco_list[0][1], + process.out.versions[0] + ).match() + + with(file(process.out.seq_dir[0][1]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Results from dataset') + assert contains('how to cite BUSCO') + } + + assert process.out.single_copy_proteins == [] + assert process.out.translated_dir == [] + } + + } + + test("test_busco_transcriptome") { + + config './nextflow.config' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/illumina/fasta/test1.contigs.fa.gz', checkIfExists: true) + ] + input[1] = 'transcriptome' + input[2] = 'bacteria_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assert process.success + + with(path(process.out.short_summaries_txt[0][1]).text) { + assert contains('BUSCO version') + assert contains('The lineage dataset is') + assert contains('BUSCO was run in mode') + assert contains('Complete BUSCOs') + assert contains('Missing BUSCOs') + assert contains('Dependencies and versions') + } + + with(path(process.out.short_summaries_json[0][1]).text) { + assert contains('one_line_summary') + assert contains('mode') + assert contains('dataset') + } + + assert snapshot( + process.out.batch_summary[0][1], + process.out.full_table[0][1], + process.out.missing_busco_list[0][1], + process.out.translated_dir[0][1], + process.out.single_copy_proteins[0][1], + process.out.versions[0] + ).match() + + with(file(process.out.seq_dir[0][1]).listFiles().collect { it.name }) { + assert contains('single_copy_busco_sequences.tar.gz') + assert contains('multi_copy_busco_sequences.tar.gz') + assert contains('fragmented_busco_sequences.tar.gz') + } + + with(path("${process.out.busco_dir[0][1]}/logs/busco.log").text) { + assert contains('DEBUG:busco.run_BUSCO') + assert contains('Results from dataset') + assert contains('how to cite BUSCO') + } + } + + } + + test("minimal-stub") { + + options '-stub' + + when { + process { + """ + input[0] = [ + [ id:'test' ], // meta map + file(params.modules_testdata_base_path + 'genomics/prokaryotes/bacteroides_fragilis/genome/genome.fna.gz', checkIfExists: true) + ] + input[1] = 'genome' + input[2] = 'bacteria_odb10' + input[3] = [] + input[4] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/busco/busco/tests/main.nf.test.snap b/modules/nf-core/busco/busco/tests/main.nf.test.snap new file mode 100644 index 00000000..1b6411bc --- /dev/null +++ b/modules/nf-core/busco/busco/tests/main.nf.test.snap @@ -0,0 +1,230 @@ +{ + "minimal-stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test-bacteria_odb10-busco.batch_summary.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + + ], + "6": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "7": [ + + ], + "8": [ + [ + { + "id": "test" + }, + [ + [ + [ + [ + + ] + ] + ] + ] + ] + ], + "9": [ + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "batch_summary": [ + [ + { + "id": "test" + }, + "test-bacteria_odb10-busco.batch_summary.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "busco_dir": [ + [ + { + "id": "test" + }, + [ + [ + [ + [ + + ] + ] + ] + ] + ] + ], + "full_table": [ + + ], + "missing_busco_list": [ + + ], + "seq_dir": [ + [ + { + "id": "test" + }, + [ + + ] + ] + ], + "short_summaries_json": [ + + ], + "short_summaries_txt": [ + + ], + "single_copy_proteins": [ + + ], + "translated_dir": [ + + ], + "versions": [ + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:28:04.451297" + }, + "test_busco_eukaryote_augustus": { + "content": [ + "test-eukaryota_odb10-busco.batch_summary.txt:md5,3ea3bdc423a461dae514d816bdc61c89", + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:26:36.974986" + }, + "test_busco_genome_single_fasta": { + "content": [ + "test-bacteria_odb10-busco.batch_summary.txt:md5,21b3fb771cf36be917cc451540d999be", + "full_table.tsv:md5,638fe7590f442c57361554dae330eca1", + "missing_busco_list.tsv:md5,1530af4fe7673a6d001349537bcd410a", + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:22:45.07816" + }, + "test_busco_genome_multi_fasta": { + "content": [ + "test-bacteria_odb10-busco.batch_summary.txt:md5,fcd3c208913e8abda3d6742c43fec5fa", + [ + "full_table.tsv:md5,c657edcc7d0de0175869717551df6e83", + "full_table.tsv:md5,638fe7590f442c57361554dae330eca1" + ], + [ + "missing_busco_list.tsv:md5,aceb66e347a353cb7fca8e2a725f9112", + "missing_busco_list.tsv:md5,1530af4fe7673a6d001349537bcd410a" + ], + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:23:50.255602" + }, + "test_busco_eukaryote_metaeuk": { + "content": [ + "test-eukaryota_odb10-busco.batch_summary.txt:md5,ff6d8277e452a83ce9456bbee666feb6", + "full_table.tsv:md5,92b1b1d5cb5ea0e2093d16f00187e8c7", + "missing_busco_list.tsv:md5,0352e563de290bf804c708323c35a9e3", + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:25:38.159041" + }, + "test_busco_transcriptome": { + "content": [ + "test-bacteria_odb10-busco.batch_summary.txt:md5,8734b3f379c4c0928e5dd4ea1873dc64", + "full_table.tsv:md5,1b2ce808fdafa744c56b5f781551272d", + "missing_busco_list.tsv:md5,a6931b6470262b997b8b99ea0f1d14a4", + [ + "1024388at2.faa:md5,797d603d262a6595a112e25b73e878b0", + "1054741at2.faa:md5,cd4b928cba6b19b4437746ba507e7195", + "1093223at2.faa:md5,df9549708e5ffcfaee6a74dd70a0e5dc", + "1151822at2.faa:md5,12726afc1cdc40c13392e1596e93df3a", + "143460at2.faa:md5,d887431fd988a5556a523440f02d9594", + "1491686at2.faa:md5,d03362d19979b27306c192f1c74a84e5", + "1504821at2.faa:md5,4f5f6e5c57bac0092c1d85ded73d7e67", + "1574817at2.faa:md5,1153e55998c2929eacad2aed7d08d248", + "1592033at2.faa:md5,bb7a59e5f3a57ba12d10dabf4c77ab57", + "1623045at2.faa:md5,8fe38155feb1802beb97ef7714837bf5", + "1661836at2.faa:md5,6c6d592c2fbb0d7a4e5e1f47a15644f0", + "1674344at2.faa:md5,bb41b44e53565a54cadf0b780532fe08", + "1698718at2.faa:md5,f233860000028eb00329aa85236c71e5", + "1990650at2.faa:md5,34a2d29c5f8b6253159ddb7a43fa1829", + "223233at2.faa:md5,dec6705c7846c989296e73942f953cbc", + "402899at2.faa:md5,acc0f271f9a586d2ce1ee41669b22999", + "505485at2.faa:md5,aa0391f8fa5d9bd19b30d844d5a99845", + "665824at2.faa:md5,47f8ad43b6a6078206feb48c2e552793", + "776861at2.faa:md5,f8b90c13f7c6be828dea3bb920195e3d", + "874197at2.faa:md5,8d22a35a768debe6f376fc695d233a69", + "932854at2.faa:md5,2eff2de1ab83b22f3234a529a44e22bb", + "95696at2.faa:md5,247bfd1aef432f7b5456307768e9149c" + ], + "single_copy_proteins.faa:md5,73e2c5d6a9b0f01f2deea3cc5f21b764", + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:27:53.992893" + }, + "test_busco_protein": { + "content": [ + "test-bacteria_odb10-busco.batch_summary.txt:md5,f5a782378f9f94a748aa907381fdef91", + "full_table.tsv:md5,812ab6a0496fccab774643cf40c4f2a8", + "missing_busco_list.tsv:md5,aceb66e347a353cb7fca8e2a725f9112", + "versions.yml:md5,3fc94714b95c2dc15399a4229d9dd1d9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-05-03T13:27:12.724862" + } +} \ No newline at end of file diff --git a/modules/nf-core/busco/busco/tests/nextflow.augustus.config b/modules/nf-core/busco/busco/tests/nextflow.augustus.config new file mode 100644 index 00000000..84daa69d --- /dev/null +++ b/modules/nf-core/busco/busco/tests/nextflow.augustus.config @@ -0,0 +1,5 @@ +process { + withName: 'BUSCO_BUSCO' { + ext.args = '--tar --augustus' + } +} diff --git a/modules/nf-core/busco/busco/tests/nextflow.config b/modules/nf-core/busco/busco/tests/nextflow.config new file mode 100644 index 00000000..1ec3fec0 --- /dev/null +++ b/modules/nf-core/busco/busco/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'BUSCO_BUSCO' { + ext.args = '--tar' + } +} diff --git a/modules/nf-core/busco/busco/tests/nextflow.metaeuk.config b/modules/nf-core/busco/busco/tests/nextflow.metaeuk.config new file mode 100644 index 00000000..c1418445 --- /dev/null +++ b/modules/nf-core/busco/busco/tests/nextflow.metaeuk.config @@ -0,0 +1,5 @@ +process { + withName: 'BUSCO_BUSCO' { + ext.args = '--tar --metaeuk' + } +} diff --git a/modules/nf-core/busco/busco/tests/old_test.yml b/modules/nf-core/busco/busco/tests/old_test.yml new file mode 100644 index 00000000..75177f5d --- /dev/null +++ b/modules/nf-core/busco/busco/tests/old_test.yml @@ -0,0 +1,624 @@ +- name: busco test_busco_genome_single_fasta + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_genome_single_fasta -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fna.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fna.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-bacteria_odb10-busco.batch_summary.txt + md5sum: bc2440f8a68d7fbf931ff911c1c3fdfa + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/bbtools_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/bbtools_out.log + md5sum: 9caf1a1434414c78562eb0bbb9c0e53f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/hmmsearch_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/hmmsearch_out.log + contains: + - "# hmmsearch :: search profile(s) against a sequence database" + - "# target sequence database:" + - "Internal pipeline statistics summary:" + - "[ok]" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/prodigal_err.log + md5sum: 538510cfc7483498210f01e53fe035ad + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/prodigal_out.log + md5sum: 61050b0706addc9498b2088a2d6efa9a + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/.checkpoint + contains: + - "Tool: prodigal" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/predicted.faa + md5sum: 836e9a80d33d8b89168f07ddc13ee991 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/predicted.fna + md5sum: 20eeb75f86842e6e136f02bca8b73a9f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.faa + md5sum: 836e9a80d33d8b89168f07ddc13ee991 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.fna + md5sum: 20eeb75f86842e6e136f02bca8b73a9f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_err.log + md5sum: 538510cfc7483498210f01e53fe035ad + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_out.log + md5sum: 61050b0706addc9498b2088a2d6efa9a + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/.bbtools_output/.checkpoint + contains: + - "Tool: bbtools" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/full_table.tsv + md5sum: c56edab1dc1522e993c25ae2b730799f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/hmmer_output.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/missing_busco_list.tsv + md5sum: b533ef30270f27160acce85a22d01bf5 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "lineage_dataset" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-bacteria_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/versions.yml + +- name: busco test_busco_genome_multi_fasta + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_genome_multi_fasta -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fasta.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fasta.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fna.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.bacteria_odb10.genome.fna.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-bacteria_odb10-busco.batch_summary.txt + md5sum: 8c64c1a28b086ef2ee444f99cbed5f7d + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/bbtools_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/bbtools_out.log + md5sum: 8f047bdb33264d22a83920bc2c63f29a + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/hmmsearch_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/hmmsearch_out.log + contains: + - "# hmmsearch :: search profile(s) against a sequence database" + - "# target sequence database:" + - "Internal pipeline statistics summary:" + - "[ok]" + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/prodigal_err.log + md5sum: c1fdc6977332f53dfe7f632733bb4585 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/logs/prodigal_out.log + md5sum: 50752acb1c5a20be886bfdfc06635bcb + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/.checkpoint + contains: + - "Tool: prodigal" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/predicted.faa + md5sum: 8166471fc5f08c82fd5643ab42327f9d + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/predicted.fna + md5sum: ddc508a18f60e7f3314534df50cdf8ca + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.faa + md5sum: 8166471fc5f08c82fd5643ab42327f9d + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.fna + md5sum: ddc508a18f60e7f3314534df50cdf8ca + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_err.log + md5sum: c1fdc6977332f53dfe7f632733bb4585 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_out.log + md5sum: 50752acb1c5a20be886bfdfc06635bcb + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_4.faa + md5sum: e56fd59c38248dc21ac94355dca98121 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_4.fna + md5sum: b365f84bf99c68357952e0b98ed7ce42 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_4_err.log + md5sum: e5f14d7925ba14a0f9850542f3739894 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_4_out.log + md5sum: d41971bfc1b621d4ffd2633bc47017ea + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/.bbtools_output/.checkpoint + contains: + - "Tool: bbtools" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/full_table.tsv + md5sum: c9651b88b10871abc260ee655898e828 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/hmmer_output.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/missing_busco_list.tsv + md5sum: 9939309df2da5419de88c32d1435c779 + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-bacteria_odb10-busco/genome.fasta/run_bacteria_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/bbtools_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/bbtools_out.log + md5sum: 9caf1a1434414c78562eb0bbb9c0e53f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/hmmsearch_err.log + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/hmmsearch_out.log + contains: + - "# hmmsearch :: search profile(s) against a sequence database" + - "# target sequence database:" + - "Internal pipeline statistics summary:" + - "[ok]" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/prodigal_err.log + md5sum: 538510cfc7483498210f01e53fe035ad + - path: output/busco/test-bacteria_odb10-busco/genome.fna/logs/prodigal_out.log + md5sum: 61050b0706addc9498b2088a2d6efa9a + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/.checkpoint + contains: + - "Tool: prodigal" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/predicted.faa + md5sum: 836e9a80d33d8b89168f07ddc13ee991 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/predicted.fna + md5sum: 20eeb75f86842e6e136f02bca8b73a9f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.faa + md5sum: 836e9a80d33d8b89168f07ddc13ee991 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11.fna + md5sum: 20eeb75f86842e6e136f02bca8b73a9f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_err.log + md5sum: 538510cfc7483498210f01e53fe035ad + - path: output/busco/test-bacteria_odb10-busco/genome.fna/prodigal_output/predicted_genes/tmp/prodigal_mode_single_code_11_out.log + md5sum: 61050b0706addc9498b2088a2d6efa9a + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/.bbtools_output/.checkpoint + contains: + - "Tool: bbtools" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/full_table.tsv + md5sum: c56edab1dc1522e993c25ae2b730799f + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/hmmer_output.tar.gz + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/missing_busco_list.tsv + md5sum: b533ef30270f27160acce85a22d01bf5 + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-bacteria_odb10-busco/genome.fna/run_bacteria_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-bacteria_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/versions.yml + +- name: busco test_busco_eukaryote_metaeuk + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_eukaryote_metaeuk -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.eukaryota_odb10.genome.fasta.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.eukaryota_odb10.genome.fasta.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-eukaryota_odb10-busco.batch_summary.txt + md5sum: ff6d8277e452a83ce9456bbee666feb6 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/bbtools_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/bbtools_out.log + md5sum: e63debaa653f18f7405d936050abc093 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/hmmsearch_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/hmmsearch_out.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run1_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run1_out.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run2_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run2_out.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/.bbtools_output/.checkpoint + contains: + - "Tool: bbtools" + - "Completed" + - "jobs" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/full_table.tsv + md5sum: bd880e90b9e5620a58943a3e0f9ff16b + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/hmmer_output.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/.checkpoint + contains: + - "Tool: metaeuk" + - "Completed" + - "jobs" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/combined_pred_proteins.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.codon.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.gff + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.headersMap.tsv + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/refseq_db_rerun.faa + md5sum: d80b8fa4cb5ed0d47d63d6aa93635bc2 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.codon.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.gff + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.headersMap.tsv + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/missing_busco_list.tsv + md5sum: 1e8e79c540fd2e69ba0d2659d9eb2988 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-eukaryota_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/versions.yml + +- name: busco test_busco_eukaryote_augustus + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_eukaryote_augustus -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.eukaryota_odb10.genome.fasta.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.eukaryota_odb10.genome.fasta.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-eukaryota_odb10-busco.batch_summary.txt + md5sum: ff6d8277e452a83ce9456bbee666feb6 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/bbtools_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/bbtools_out.log + md5sum: e63debaa653f18f7405d936050abc093 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/hmmsearch_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/hmmsearch_out.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run1_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run1_out.log + contains: + - "metaeuk" + - "easy-predict" + - "Compute score and coverage" + - "Time for processing:" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run2_err.log + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/logs/metaeuk_run2_out.log + contains: + - "metaeuk" + - "easy-predict" + - "Compute score and coverage" + - "Time for processing:" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/.bbtools_output/.checkpoint + contains: + - "Tool: bbtools" + - "Completed" + - "jobs" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/full_table.tsv + md5sum: bd880e90b9e5620a58943a3e0f9ff16b + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/hmmer_output.tar.gz + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/.checkpoint + contains: + - "Tool: metaeuk" + - "Completed" + - "jobs" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/combined_pred_proteins.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.codon.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.gff + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/initial_results/genome.fasta.headersMap.tsv + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/refseq_db_rerun.faa + md5sum: d80b8fa4cb5ed0d47d63d6aa93635bc2 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.codon.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.fas + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.gff + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/metaeuk_output/rerun_results/genome.fasta.headersMap.tsv + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/missing_busco_list.tsv + md5sum: 1e8e79c540fd2e69ba0d2659d9eb2988 + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-eukaryota_odb10-busco/genome.fasta/run_eukaryota_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-eukaryota_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/versions.yml + +- name: busco test_busco_protein + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_protein -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.bacteria_odb10.proteome.fasta.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.bacteria_odb10.proteome.fasta.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-bacteria_odb10-busco.batch_summary.txt + md5sum: 7a65e6cbb6c56a2ea4e739ae0aa3297d + - path: output/busco/test-bacteria_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/logs/hmmsearch_err.log + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/logs/hmmsearch_out.log + contains: + - "# hmmsearch :: search profile(s) against a sequence database" + - "# target sequence database:" + - "Internal pipeline statistics summary:" + - "[ok]" + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/full_table.tsv + md5sum: 0e34f1011cd83ea1d5d5103ec62b8922 + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/hmmer_output.tar.gz + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/missing_busco_list.tsv + md5sum: 9939309df2da5419de88c32d1435c779 + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-bacteria_odb10-busco/proteome.fasta/run_bacteria_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/versions.yml + +- name: busco test_busco_transcriptome + command: nextflow run ./tests/modules/nf-core/busco -entry test_busco_transcriptome -c ./tests/config/nextflow.config + tags: + - busco + files: + - path: output/busco/short_summary.specific.bacteria_odb10.test1.contigs.fa.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/short_summary.specific.bacteria_odb10.test1.contigs.fa.txt + contains: + - "BUSCO version" + - "The lineage dataset is" + - "BUSCO was run in mode" + - "Complete BUSCOs" + - "Missing BUSCOs" + - "Dependencies and versions" + - path: output/busco/test-bacteria_odb10-busco.batch_summary.txt + md5sum: 46118ecf60d1b87d22b96d80f4f03632 + - path: output/busco/test-bacteria_odb10-busco/logs/busco.log + contains: + - "DEBUG:busco.run_BUSCO" + - "Results from dataset" + - "how to cite BUSCO" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/.checkpoint + contains: + - "Tool: makeblastdb" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.ndb + md5sum: 3788c017fe5e6f0f58224e9cdd21822b + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.nhr + md5sum: 8ecd2ce392bb5e25ddbe1d85f879582e + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.nin + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.njs + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.not + md5sum: 0c340e376c7e85d19f82ec1a833e6a6e + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.nsq + md5sum: 532d5c0a7ea00fe95ca3c97cb3be6198 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.ntf + md5sum: de1250813f0c7affc6d12dac9d0fb6bb + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/blast_db/test1.contigs.fa.nto + md5sum: ff74bd41f9cc9b011c63a32c4f7693bf + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/hmmsearch_err.log + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/hmmsearch_out.log + contains: + - "# hmmsearch :: search profile(s) against a sequence database" + - "# target sequence database:" + - "Internal pipeline statistics summary:" + - "[ok]" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/makeblastdb_err.log + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/makeblastdb_out.log + contains: + - "Building a new DB" + - "Adding sequences from FASTA" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/tblastn_err.log + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/logs/tblastn_out.log + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/.checkpoint + contains: + - "Tool: tblastn" + - "Completed" + - "jobs" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/coordinates.tsv + md5sum: cc30eed321944af293452bdbcfc24292 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_101.temp + md5sum: 73e9c65fc83fedc58f57f09b08f08238 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_119.temp + md5sum: 7fa4cc7955ec0cc36330a221c579b975 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_129.temp + md5sum: 6f1601c875d019e3f6f1f98ed8e988d4 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_138.temp + md5sum: 3f8e034686cd240c2330650d791bcae2 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_143.temp + md5sum: df3dfa8e9ba30ed70cf75b5e7abf2179 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_172.temp + md5sum: 7d463e0e6cf7169bc9077d8dc776dda1 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_178.temp + md5sum: 2288edf7fa4f88f51b4cf4d94086f77e + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_188.temp + md5sum: 029906abbad6d87fc57830dd548cac24 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_195.temp + md5sum: 4937f3b348774a31b1160a00297c29cc + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_210.temp + md5sum: afcb20ba4c466479d6b91c8c62251e1f + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_232.temp + md5sum: 2e1e823ce017345bd998191a39fa9924 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_268.temp + md5sum: 08c2d82c34ecffbe1c638b410349412e + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_29.temp + md5sum: cd9b63cf93524284781535c888313764 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_44.temp + md5sum: d1929b742b24ebe379bf4801ca882dca + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_58.temp + md5sum: 69215765b010c05336538cb322c900b3 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_72.temp + md5sum: 6feaa1cc3b0899a147ea9d466878f3e3 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_80.temp + md5sum: 13625eae14e860a96ce17cd4e37e9d01 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_81.temp + md5sum: e14b2484649b0dbc8926815c207b806d + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_93.temp + md5sum: 6902c93691df00e690faea914c71839e + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/sequences/k141_97.temp + md5sum: 0a0d9d38a83acbd5ad43c29cdf429988 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/blast_output/tblastn.tsv + contains: + - "TBLASTN" + - "BLAST processed" + - "queries" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/busco_sequences/fragmented_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/busco_sequences/multi_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/busco_sequences/single_copy_busco_sequences.tar.gz + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/full_table.tsv + md5sum: 24df25199e13c88bd892fc3e7b541ca0 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/hmmer_output.tar.gz + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/missing_busco_list.tsv + md5sum: e7232e2b8cca4fdfdd9e363b39ebbc81 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/short_summary.json + contains: + - "one_line_summary" + - "mode" + - "dataset" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/short_summary.txt + contains: + - "# BUSCO version is:" + - "Results:" + - "busco:" + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/run_bacteria_odb10/single_copy_proteins.faa + md5sum: e04b9465733577ae6e4bccb7aa01e720 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1024388at2.faa + md5sum: 7333c39a20258f20c7019ea0cd83157c + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1054741at2.faa + md5sum: ebb481e77a824685fbe04d8a2f3a0d7d + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1093223at2.faa + md5sum: 34621c7d499034e8f8e6b92fd4020a93 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1151822at2.faa + md5sum: aa89ca381c1c70c9c4e1380351ca7c2a + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/143460at2.faa + md5sum: f2e91d78b8dd3722840378789f29e8c8 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1491686at2.faa + md5sum: 73c25aef5c9cba7f4151804941b146ea + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1504821at2.faa + md5sum: cda556018d1f84ebe517e89f6fc107d0 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1574817at2.faa + md5sum: a9096c9fb8b25c78a72871ab0463acdc + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1592033at2.faa + md5sum: e463d25ce186c0cebfd749474f3a4c64 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1623045at2.faa + md5sum: f2cfd241590c6d8377286d6135480937 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1661836at2.faa + md5sum: 586569546fb9861502468e3d9ba2775c + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1674344at2.faa + md5sum: 24c658bee14ad84b062d81ad96642eb8 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1698718at2.faa + md5sum: 0b8e26ddf5149bbd8805be7af125208d + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/1990650at2.faa + md5sum: 159320712ee01fb2ccb31a25df44eead + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/223233at2.faa + md5sum: 812629c0b06ac3d18661c2ca78de0c08 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/402899at2.faa + md5sum: f7ff4e1591342d30b77392a2e84b57d9 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/505485at2.faa + md5sum: 7b34a24fc49c540d46fcf96ff5129564 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/665824at2.faa + md5sum: 4cff2df64f6bcaff8bc19c234c8bcccd + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/776861at2.faa + md5sum: 613af7a3fea30ea2bece66f603b9284a + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/874197at2.faa + md5sum: a7cd1b13c9ef91c7ef4e31614166f197 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/932854at2.faa + md5sum: fe313ffd5efdb0fed887a04fba352552 + - path: output/busco/test-bacteria_odb10-busco/test1.contigs.fa/translated_proteins/95696at2.faa + md5sum: 4e1f30a2fea4dfbf9bb7fae2700622a0 + - path: output/busco/versions.yml diff --git a/modules/nf-core/busco/busco/tests/tags.yml b/modules/nf-core/busco/busco/tests/tags.yml new file mode 100644 index 00000000..7c4d2835 --- /dev/null +++ b/modules/nf-core/busco/busco/tests/tags.yml @@ -0,0 +1,2 @@ +busco/busco: + - "modules/nf-core/busco/busco/**" diff --git a/modules/nf-core/bwamem2/index/tests/main.nf.test b/modules/nf-core/bwamem2/index/tests/main.nf.test new file mode 100644 index 00000000..dbf11132 --- /dev/null +++ b/modules/nf-core/bwamem2/index/tests/main.nf.test @@ -0,0 +1,31 @@ +nextflow_process { + + name "Test Process BWAMEM2_INDEX" + tag "modules_nfcore" + tag "modules" + tag "bwamem2" + tag "bwamem2/index" + script "../main.nf" + process "BWAMEM2_INDEX" + + test("BWAMEM2 index") { + + when { + process { + """ + input[0] = [ + [id: 'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/bwamem2/index/tests/main.nf.test.snap b/modules/nf-core/bwamem2/index/tests/main.nf.test.snap new file mode 100644 index 00000000..69b268ee --- /dev/null +++ b/modules/nf-core/bwamem2/index/tests/main.nf.test.snap @@ -0,0 +1,47 @@ +{ + "BWAMEM2 index": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + [ + "genome.fasta.0123:md5,b02870de80106104abcb03cd9463e7d8", + "genome.fasta.amb:md5,3a68b8b2287e07dd3f5f95f4344ba76e", + "genome.fasta.ann:md5,c32e11f6c859f166c7525a9c1d583567", + "genome.fasta.bwt.2bit.64:md5,d097a1b82dee375d41a1ea69895a9216", + "genome.fasta.pac:md5,983e3d2cd6f36e2546e6d25a0da78d66" + ] + ] + ], + "1": [ + "versions.yml:md5,9ffd13d12e7108ed15c58566bc4717d6" + ], + "index": [ + [ + { + "id": "test" + }, + [ + "genome.fasta.0123:md5,b02870de80106104abcb03cd9463e7d8", + "genome.fasta.amb:md5,3a68b8b2287e07dd3f5f95f4344ba76e", + "genome.fasta.ann:md5,c32e11f6c859f166c7525a9c1d583567", + "genome.fasta.bwt.2bit.64:md5,d097a1b82dee375d41a1ea69895a9216", + "genome.fasta.pac:md5,983e3d2cd6f36e2546e6d25a0da78d66" + ] + ] + ], + "versions": [ + "versions.yml:md5,9ffd13d12e7108ed15c58566bc4717d6" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.02.0" + }, + "timestamp": "2024-03-18T12:59:39.132616" + } +} \ No newline at end of file diff --git a/modules/nf-core/bwamem2/index/tests/tags.yml b/modules/nf-core/bwamem2/index/tests/tags.yml new file mode 100644 index 00000000..3953018e --- /dev/null +++ b/modules/nf-core/bwamem2/index/tests/tags.yml @@ -0,0 +1,2 @@ +bwamem2/index: + - modules/nf-core/bwamem2/index/** diff --git a/modules/nf-core/gnu/sort/tests/main.nf.test b/modules/nf-core/gnu/sort/tests/main.nf.test new file mode 100644 index 00000000..e4030187 --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/main.nf.test @@ -0,0 +1,120 @@ +nextflow_process { + + name "Test Process GNU_SORT" + script "modules/nf-core/gnu/sort/main.nf" + process "GNU_SORT" + + tag "modules" + tag "modules_nfcore" + tag "gnu" + tag "gnu/sort" + + test("unsorted_genome_sort") { + config "./sort_simple_bed.config" + + when { + process { + """ + input[0] = [ + [id:'genome_test'], + file(params.test_data['generic']['unsorted_data']['unsorted_text']['genome_file'], + checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.sorted[0][1]).name + ).match("genome_sort") + } + ) + } + + } + + test("unsorted_intervals_sort") { + config "./sort_simple_bed.config" + when { + process { + """ + input[0] = [ + [id:'test'], + file(params.test_data['generic']['unsorted_data']['unsorted_text']['intervals'], + checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.sorted[0][1]).name + ).match("interval_sort") + } + ) + } + + } + + test("unsorted_csv_sort") { + config "./sort_complex.config" + + when { + process { + """ + input[0] = [ + [id:'test'], + file(params.test_data['generic']['unsorted_data']['unsorted_text']['numbers_csv'], + checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.sorted[0][1]).name + ).match("csv_sort") + } + ) + } + + } + + test("unsorted_csv_sort_stub") { + config "./sort_complex.config" + options "-stub" + + when { + process { + """ + input[0] = [ + [id:'test'], + file(params.test_data['generic']['unsorted_data']['unsorted_text']['numbers_csv'], + checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + + } + +} diff --git a/modules/nf-core/gnu/sort/tests/main.nf.test.snap b/modules/nf-core/gnu/sort/tests/main.nf.test.snap new file mode 100644 index 00000000..63891bc4 --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/main.nf.test.snap @@ -0,0 +1,164 @@ +{ + "unsorted_csv_sort": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.csv.sorted:md5,0b52d1b4c4a0c6e972c6f94aafd75a1d" + ] + ], + "1": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ], + "sorted": [ + [ + { + "id": "test" + }, + "test.csv.sorted:md5,0b52d1b4c4a0c6e972c6f94aafd75a1d" + ] + ], + "versions": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:44.714632791" + }, + "interval_sort": { + "content": [ + "test.bed.sorted" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:37.962807086" + }, + "unsorted_csv_sort_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.csv.sorted:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ], + "sorted": [ + [ + { + "id": "test" + }, + "test.csv.sorted:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:51.456258705" + }, + "csv_sort": { + "content": [ + "test.csv.sorted" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:44.725431761" + }, + "unsorted_genome_sort": { + "content": [ + { + "0": [ + [ + { + "id": "genome_test" + }, + "genome_test.bed.sorted:md5,fd97f7efafdbbfa71d9b560f10b4b048" + ] + ], + "1": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ], + "sorted": [ + [ + { + "id": "genome_test" + }, + "genome_test.bed.sorted:md5,fd97f7efafdbbfa71d9b560f10b4b048" + ] + ], + "versions": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:31.041778719" + }, + "genome_sort": { + "content": [ + "genome_test.bed.sorted" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:31.060201722" + }, + "unsorted_intervals_sort": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bed.sorted:md5,abbce903ef263d38b2f71856387799ab" + ] + ], + "1": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ], + "sorted": [ + [ + { + "id": "test" + }, + "test.bed.sorted:md5,abbce903ef263d38b2f71856387799ab" + ] + ], + "versions": [ + "versions.yml:md5,dd412503ec9dd665203e083ea44326cb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T11:13:37.951397547" + } +} \ No newline at end of file diff --git a/modules/nf-core/gnu/sort/tests/sort_complex.config b/modules/nf-core/gnu/sort/tests/sort_complex.config new file mode 100644 index 00000000..103eaaf6 --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/sort_complex.config @@ -0,0 +1,6 @@ +process { + withName: GNU_SORT { + ext.args = { "-t ';' -g -k 1,1 -k 2,2" } + ext.suffix = { "csv.sorted" } + } +} \ No newline at end of file diff --git a/modules/nf-core/gnu/sort/tests/sort_simple_bed.config b/modules/nf-core/gnu/sort/tests/sort_simple_bed.config new file mode 100644 index 00000000..d7d52e0f --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/sort_simple_bed.config @@ -0,0 +1,6 @@ +process { + withName: GNU_SORT { + ext.args = { "-k1,1 -k2,2n" } + ext.suffix = { "bed.sorted" } + } +} \ No newline at end of file diff --git a/modules/nf-core/gnu/sort/tests/sort_simple_genome.config b/modules/nf-core/gnu/sort/tests/sort_simple_genome.config new file mode 100644 index 00000000..4dcec385 --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/sort_simple_genome.config @@ -0,0 +1,6 @@ +process { + withName: GNU_SORT { + ext.args = { "-k1,1 -k2,2n" } + ext.suffix = { "genome.sorted" } + } +} \ No newline at end of file diff --git a/modules/nf-core/gnu/sort/tests/tags.yml b/modules/nf-core/gnu/sort/tests/tags.yml new file mode 100644 index 00000000..ac40e376 --- /dev/null +++ b/modules/nf-core/gnu/sort/tests/tags.yml @@ -0,0 +1,2 @@ +gnu/sort: + - "modules/nf-core/gnu/sort/**" diff --git a/modules/nf-core/minimap2/index/tests/main.nf.test b/modules/nf-core/minimap2/index/tests/main.nf.test new file mode 100644 index 00000000..97840ff7 --- /dev/null +++ b/modules/nf-core/minimap2/index/tests/main.nf.test @@ -0,0 +1,32 @@ +nextflow_process { + + name "Test Process MINIMAP2_INDEX" + script "../main.nf" + process "MINIMAP2_INDEX" + + tag "modules" + tag "modules_nfcore" + tag "minimap2" + tag "minimap2/index" + + test("minimap2 index") { + + when { + process { + """ + input[0] = [ + [ id:'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + + then { + assert process.success + assert snapshot(process.out).match() + } + + } + +} \ No newline at end of file diff --git a/modules/nf-core/minimap2/index/tests/main.nf.test.snap b/modules/nf-core/minimap2/index/tests/main.nf.test.snap new file mode 100644 index 00000000..0b098828 --- /dev/null +++ b/modules/nf-core/minimap2/index/tests/main.nf.test.snap @@ -0,0 +1,68 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + [ + { + "id": "test_ref" + }, + "genome.mmi:md5,72e450f12dc691e763c697463bdb1571" + ] + ], + "1": [ + "versions.yml:md5,0fced0ee8015e7f50b82566e3db8f7b0" + ], + "index": [ + [ + { + "id": "test_ref" + }, + "genome.mmi:md5,72e450f12dc691e763c697463bdb1571" + ] + ], + "versions": [ + "versions.yml:md5,0fced0ee8015e7f50b82566e3db8f7b0" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T11:46:30.000058092" + }, + "minimap2 index": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "genome.mmi:md5,72e450f12dc691e763c697463bdb1571" + ] + ], + "1": [ + "versions.yml:md5,2f8340380c6741e9261a284262a90bde" + ], + "index": [ + [ + { + "id": "test" + }, + "genome.mmi:md5,72e450f12dc691e763c697463bdb1571" + ] + ], + "versions": [ + "versions.yml:md5,2f8340380c6741e9261a284262a90bde" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-04-05T10:58:29.828187662" + } +} \ No newline at end of file diff --git a/modules/nf-core/minimap2/index/tests/tags.yml b/modules/nf-core/minimap2/index/tests/tags.yml new file mode 100644 index 00000000..e5ef8e19 --- /dev/null +++ b/modules/nf-core/minimap2/index/tests/tags.yml @@ -0,0 +1,2 @@ +minimap2/index: + - modules/nf-core/minimap2/index/** diff --git a/modules/nf-core/miniprot/align/tests/main.nf.test b/modules/nf-core/miniprot/align/tests/main.nf.test new file mode 100644 index 00000000..12366934 --- /dev/null +++ b/modules/nf-core/miniprot/align/tests/main.nf.test @@ -0,0 +1,89 @@ + +nextflow_process { + + name "Test Process MINIPROT_ALIGN" + script "../main.nf" + process "MINIPROT_ALIGN" + + + tag "modules" + tag "modules_nfcore" + tag "miniprot" + tag "miniprot/align" + tag "miniprot/index" + + setup { + run("MINIPROT_INDEX") { + script "../../index/main.nf" + process { + """ + input[0] =[ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + """ + } + } + } + + test("test-miniprot-align-gff") { + config "./nextflow.gff.config" + + when { + process { + """ + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/proteome.fasta', checkIfExists: true)] + input[1] = MINIPROT_INDEX.out.index + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test-miniprot-align-paf") { + config "./nextflow.paf.config" + + when { + process { + """ + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/proteome.fasta', checkIfExists: true)] + input[1] = MINIPROT_INDEX.out.index + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test-miniprot-align-paf-stub") { + config "./nextflow.paf.config" + options '-stub' + when { + process { + """ + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/proteome.fasta', checkIfExists: true)] + input[1] = MINIPROT_INDEX.out.index + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/miniprot/align/tests/main.nf.test.snap b/modules/nf-core/miniprot/align/tests/main.nf.test.snap new file mode 100644 index 00000000..63f41136 --- /dev/null +++ b/modules/nf-core/miniprot/align/tests/main.nf.test.snap @@ -0,0 +1,119 @@ +{ + "test-miniprot-align-paf-stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + "versions.yml:md5,cd4a5baa0b71a4edc70e556289a35ee9" + ], + "gff": [ + + ], + "paf": [ + [ + { + "id": "test" + }, + "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,cd4a5baa0b71a4edc70e556289a35ee9" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-30T13:45:20.16677" + }, + "test-miniprot-align-paf": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.paf:md5,f2b40da6a9605df44efc9df14b255b53" + ] + ], + "1": [ + + ], + "2": [ + "versions.yml:md5,cd4a5baa0b71a4edc70e556289a35ee9" + ], + "gff": [ + + ], + "paf": [ + [ + { + "id": "test" + }, + "test.paf:md5,f2b40da6a9605df44efc9df14b255b53" + ] + ], + "versions": [ + "versions.yml:md5,cd4a5baa0b71a4edc70e556289a35ee9" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-30T13:45:15.160286" + }, + "test-miniprot-align-gff": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test" + }, + "test.gff:md5,dc2d01ac840ee26416b5eb9cf252181d" + ] + ], + "2": [ + "versions.yml:md5,cd4a5baa0b71a4edc70e556289a35ee9" + ], + "gff": [ + [ + { + "id": "test" + }, + "test.gff:md5,dc2d01ac840ee26416b5eb9cf252181d" + ] + ], + "paf": [ + + ], + "versions": [ + "versions.yml:md5,cd4a5baa0b71a4edc70e556289a35ee9" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-30T13:45:09.941901" + } +} \ No newline at end of file diff --git a/modules/nf-core/miniprot/align/tests/nextflow.gff.config b/modules/nf-core/miniprot/align/tests/nextflow.gff.config new file mode 100644 index 00000000..f97d4fd2 --- /dev/null +++ b/modules/nf-core/miniprot/align/tests/nextflow.gff.config @@ -0,0 +1,5 @@ +process { + withName: 'MINIPROT_ALIGN' { + ext.args = "-u --gff" + } +} diff --git a/modules/nf-core/miniprot/align/tests/nextflow.paf.config b/modules/nf-core/miniprot/align/tests/nextflow.paf.config new file mode 100644 index 00000000..8d9c2550 --- /dev/null +++ b/modules/nf-core/miniprot/align/tests/nextflow.paf.config @@ -0,0 +1,5 @@ +process { + withName: 'MINIPROT_ALIGN' { + ext.args = "-u" + } +} diff --git a/modules/nf-core/miniprot/index/tests/main.nf.test b/modules/nf-core/miniprot/index/tests/main.nf.test new file mode 100644 index 00000000..b6092df9 --- /dev/null +++ b/modules/nf-core/miniprot/index/tests/main.nf.test @@ -0,0 +1,51 @@ + +nextflow_process { + + name "Test Process MINIPROT_INDEX" + script "../main.nf" + process "MINIPROT_INDEX" + + tag "modules" + tag "modules_nfcore" + tag "miniprot" + tag "miniprot/index" + + test("test-miniprot-index") { + + when { + process { + """ + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test-miniprot-index-stub") { + options '-stub' + when { + process { + """ + input[0] = [ [id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/miniprot/index/tests/main.nf.test.snap b/modules/nf-core/miniprot/index/tests/main.nf.test.snap new file mode 100644 index 00000000..3bfc4b72 --- /dev/null +++ b/modules/nf-core/miniprot/index/tests/main.nf.test.snap @@ -0,0 +1,68 @@ +{ + "test-miniprot-index": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "genome.mpi:md5,6161e75cdeca970d844b6cfada14766b" + ] + ], + "1": [ + "versions.yml:md5,1e6ea592f24125bd879956ea78f6afeb" + ], + "index": [ + [ + { + "id": "test" + }, + "genome.mpi:md5,6161e75cdeca970d844b6cfada14766b" + ] + ], + "versions": [ + "versions.yml:md5,1e6ea592f24125bd879956ea78f6afeb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-30T13:35:37.561483" + }, + "test-miniprot-index-stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "genome.mpi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,1e6ea592f24125bd879956ea78f6afeb" + ], + "index": [ + [ + { + "id": "test" + }, + "genome.mpi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,1e6ea592f24125bd879956ea78f6afeb" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-30T13:35:42.977101" + } +} \ No newline at end of file diff --git a/modules/nf-core/paftools/sam2paf/tests/main.nf.test b/modules/nf-core/paftools/sam2paf/tests/main.nf.test new file mode 100644 index 00000000..be31cc33 --- /dev/null +++ b/modules/nf-core/paftools/sam2paf/tests/main.nf.test @@ -0,0 +1,57 @@ + +nextflow_process { + + name "Test Process PAFTOOLS_SAM2PAF" + script "../main.nf" + process "PAFTOOLS_SAM2PAF" + + tag "modules" + tag "modules_nfcore" + tag "paftools" + tag "paftools/sam2paf" + + test("test-paftools-sam2paf") { + + when { + process { + """ + input[0] = [ + [id:'test'], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/scramble/test.bam', checkIfExists: true) + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test-paftools-sam2paf-stub") { + options '-stub' + when { + process { + """ + input[0] = [ + [id:'test'], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/scramble/test.bam', checkIfExists: true) + ] + + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/paftools/sam2paf/tests/main.nf.test.snap b/modules/nf-core/paftools/sam2paf/tests/main.nf.test.snap new file mode 100644 index 00000000..3e7ab899 --- /dev/null +++ b/modules/nf-core/paftools/sam2paf/tests/main.nf.test.snap @@ -0,0 +1,68 @@ +{ + "test-paftools-sam2paf": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.paf:md5,bf981d964f3ffa6feac079199e157330" + ] + ], + "1": [ + "versions.yml:md5,ae0342a5ff0006c183531b23d9fb5d4f" + ], + "paf": [ + [ + { + "id": "test" + }, + "test.paf:md5,bf981d964f3ffa6feac079199e157330" + ] + ], + "versions": [ + "versions.yml:md5,ae0342a5ff0006c183531b23d9fb5d4f" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-30T12:37:30.82847" + }, + "test-paftools-sam2paf-stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,88072120e3a09a8338ce7ae0c844067e" + ], + "paf": [ + [ + { + "id": "test" + }, + "test.paf:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,88072120e3a09a8338ce7ae0c844067e" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.4" + }, + "timestamp": "2024-08-30T12:37:35.457832" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test b/modules/nf-core/samtools/faidx/tests/main.nf.test new file mode 100644 index 00000000..17244ef2 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/main.nf.test @@ -0,0 +1,122 @@ +nextflow_process { + + name "Test Process SAMTOOLS_FAIDX" + script "../main.nf" + process "SAMTOOLS_FAIDX" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/faidx" + + test("test_samtools_faidx") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_bgzip") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.gz', checkIfExists: true)] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_fasta") { + + config "./nextflow.config" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_stub_fasta") { + + config "./nextflow2.config" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta.fai', checkIfExists: true) ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_samtools_faidx_stub_fai") { + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) ] + + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/main.nf.test.snap b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap new file mode 100644 index 00000000..1bbb3ec2 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/main.nf.test.snap @@ -0,0 +1,249 @@ +{ + "test_samtools_faidx": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:57:47.450887871" + }, + "test_samtools_faidx_bgzip": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.gz.gzi:md5,7dea362b3fac8e00956a4952a3d4f474" + ] + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:04.804905659" + }, + "test_samtools_faidx_fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,6a0774a0ad937ba0bfd2ac7457d90f36" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,6a0774a0ad937ba0bfd2ac7457d90f36" + ] + ], + "fai": [ + + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:23.831268154" + }, + "test_samtools_faidx_stub_fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + [ + { + "id": "test", + "single_end": false + }, + "extract.fa:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "fai": [ + + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:35.600243706" + }, + "test_samtools_faidx_stub_fai": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ], + "fa": [ + + ], + "fai": [ + [ + { + "id": "test", + "single_end": false + }, + "genome.fasta.fai:md5,9da2a56e2853dc8c0b86a9e7229c9fe5" + ] + ], + "gzi": [ + + ], + "versions": [ + "versions.yml:md5,6bbe80a2e14bd61202ca63e12d66027f" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-16T07:58:54.705460167" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/faidx/tests/nextflow.config b/modules/nf-core/samtools/faidx/tests/nextflow.config new file mode 100644 index 00000000..f76a3ba0 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: SAMTOOLS_FAIDX { + ext.args = 'MT192765.1 -o extract.fa' + } + +} diff --git a/modules/nf-core/samtools/faidx/tests/nextflow2.config b/modules/nf-core/samtools/faidx/tests/nextflow2.config new file mode 100644 index 00000000..33ebbd5d --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/nextflow2.config @@ -0,0 +1,6 @@ +process { + + withName: SAMTOOLS_FAIDX { + ext.args = '-o extract.fa' + } +} diff --git a/modules/nf-core/samtools/faidx/tests/tags.yml b/modules/nf-core/samtools/faidx/tests/tags.yml new file mode 100644 index 00000000..e4a83948 --- /dev/null +++ b/modules/nf-core/samtools/faidx/tests/tags.yml @@ -0,0 +1,2 @@ +samtools/faidx: + - modules/nf-core/samtools/faidx/** diff --git a/modules/nf-core/samtools/markdup/tests/main.nf.test b/modules/nf-core/samtools/markdup/tests/main.nf.test new file mode 100644 index 00000000..acfbd1c1 --- /dev/null +++ b/modules/nf-core/samtools/markdup/tests/main.nf.test @@ -0,0 +1,90 @@ +nextflow_process { + + name "Test Process SAMTOOLS_MARKDUP" + script "../main.nf" + process "SAMTOOLS_MARKDUP" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "samtools" + tag "samtools/fixmate" + tag "samtools/sort" + tag "samtools/markdup" + + test("sarscov2 - bam") { + setup { + run("SAMTOOLS_FIXMATE") { + script "../../fixmate/main.nf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + file(params.test_data['sarscov2']['illumina']['test_paired_end_bam'], checkIfExists: true), + ] + """ + } + } + run("SAMTOOLS_SORT") { + script "../../sort/main.nf" + process { + """ + input[0] = SAMTOOLS_FIXMATE.out.bam + input[1] = [ + [ id:'fasta' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true), + ] + """ + } + } + } + when { + process { + """ + input[0] = SAMTOOLS_SORT.out.bam + input[1] = [ + [ id:'fasta' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true), + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("sarscov2 - bam - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], + file(params.test_data['sarscov2']['illumina']['test_paired_end_sorted_bam'], checkIfExists: true), + ] + input[1] = [ + [ id:'fasta' ], + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true), + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/samtools/markdup/tests/main.nf.test.snap b/modules/nf-core/samtools/markdup/tests/main.nf.test.snap new file mode 100644 index 00000000..4e7cbf5e --- /dev/null +++ b/modules/nf-core/samtools/markdup/tests/main.nf.test.snap @@ -0,0 +1,96 @@ +{ + "sarscov2 - bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.markdup.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,4ce5394244e549f97b8250b7dfad71ba" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.markdup.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "cram": [ + + ], + "sam": [ + + ], + "versions": [ + "versions.yml:md5,4ce5394244e549f97b8250b7dfad71ba" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-17T08:46:57.510270753" + }, + "sarscov2 - bam": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.markdup.bam:md5,e73ea77e3857e7c6b0e6db2ec660361f" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,4ce5394244e549f97b8250b7dfad71ba" + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.markdup.bam:md5,e73ea77e3857e7c6b0e6db2ec660361f" + ] + ], + "cram": [ + + ], + "sam": [ + + ], + "versions": [ + "versions.yml:md5,4ce5394244e549f97b8250b7dfad71ba" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-17T08:51:17.068686604" + } +} \ No newline at end of file diff --git a/modules/nf-core/samtools/markdup/tests/nextflow.config b/modules/nf-core/samtools/markdup/tests/nextflow.config new file mode 100644 index 00000000..1a2b52b9 --- /dev/null +++ b/modules/nf-core/samtools/markdup/tests/nextflow.config @@ -0,0 +1,14 @@ +process { + withName: SAMTOOLS_COLLATE { + ext.prefix = { "${meta.id}.collate" } + } + withName: SAMTOOLS_FIXMATE { + ext.prefix = { "${meta.id}.fixmate" } + } + withName: SAMTOOLS_SORT { + ext.prefix = { "${meta.id}.sorted" } + } + withName: SAMTOOLS_MARKDUP { + ext.prefix = { "${meta.id}.markdup" } + } +} diff --git a/modules/nf-core/samtools/sort/tests/nextflow_cram.config b/modules/nf-core/samtools/sort/tests/nextflow_cram.config new file mode 100644 index 00000000..3a8c0188 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/nextflow_cram.config @@ -0,0 +1,8 @@ +process { + + withName: SAMTOOLS_SORT { + ext.prefix = { "${meta.id}.sorted" } + ext.args = "--write-index --output-fmt cram" + } + +} diff --git a/modules/nf-core/seqtk/cutn/tests/main.nf.test b/modules/nf-core/seqtk/cutn/tests/main.nf.test new file mode 100644 index 00000000..46dfff1f --- /dev/null +++ b/modules/nf-core/seqtk/cutn/tests/main.nf.test @@ -0,0 +1,57 @@ +nextflow_process { + + name "Test Process SEQTK_CUTN" + script "../main.nf" + process "SEQTK_CUTN" + + tag "modules" + tag "modules_nfcore" + tag "seqtk" + tag "seqtk/cutn" + + test("homo_21_cut") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.bed[0][1]).name + ).match("genome_cut") + } + ) + } + } + + test("homo_21_cut_stub") { + options "-stub" + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/seqtk/cutn/tests/main.nf.test.snap b/modules/nf-core/seqtk/cutn/tests/main.nf.test.snap new file mode 100644 index 00000000..998beda5 --- /dev/null +++ b/modules/nf-core/seqtk/cutn/tests/main.nf.test.snap @@ -0,0 +1,70 @@ +{ + "genome_cut": { + "content": [ + "test.bed" + ], + "timestamp": "2024-02-22T16:02:14.744148" + }, + "homo_21_cut_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,3da8ed2738f3c093d1e62d796fd76428" + ], + "bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bed:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3da8ed2738f3c093d1e62d796fd76428" + ] + } + ], + "timestamp": "2024-02-22T16:02:23.596389" + }, + "homo_21_cut": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bed:md5,16cbba84e3a4bdbb52217afb5051f948" + ] + ], + "1": [ + "versions.yml:md5,3da8ed2738f3c093d1e62d796fd76428" + ], + "bed": [ + [ + { + "id": "test", + "single_end": true + }, + "test.bed:md5,16cbba84e3a4bdbb52217afb5051f948" + ] + ], + "versions": [ + "versions.yml:md5,3da8ed2738f3c093d1e62d796fd76428" + ] + } + ], + "timestamp": "2024-02-22T16:02:14.695205" + } +} \ No newline at end of file diff --git a/modules/nf-core/seqtk/cutn/tests/tags.yml b/modules/nf-core/seqtk/cutn/tests/tags.yml new file mode 100644 index 00000000..13c64cc3 --- /dev/null +++ b/modules/nf-core/seqtk/cutn/tests/tags.yml @@ -0,0 +1,2 @@ +seqtk/cutn: + - "modules/nf-core/seqtk/cutn/**" diff --git a/modules/nf-core/tabix/bgziptabix/tests/main.nf.test b/modules/nf-core/tabix/bgziptabix/tests/main.nf.test new file mode 100644 index 00000000..4d4130dc --- /dev/null +++ b/modules/nf-core/tabix/bgziptabix/tests/main.nf.test @@ -0,0 +1,123 @@ +nextflow_process { + + name "Test Process TABIX_BGZIPTABIX" + script "modules/nf-core/tabix/bgziptabix/main.nf" + process "TABIX_BGZIPTABIX" + + tag "modules" + tag "modules_nfcore" + tag "tabix" + tag "tabix/bgziptabix" + + test("sarscov2_bed_tbi") { + config "./tabix_tbi.config" + + when { + process { + """ + input[0] = [ + [ id:'tbi_test' ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.gz_tbi[0][1]).name + ).match("tbi_test") + } + ) + } + } + + test("sarscov2_bed_csi") { + config "./tabix_csi.config" + + when { + process { + """ + input[0] = [ + [ id:'csi_test' ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.gz_csi[0][1]).name + ).match("csi_test") + } + ) + } + + } + + test("sarscov2_bed_csi_stub") { + config "./tabix_csi.config" + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.gz_csi[0][1]).name + ).match("csi_stub") + } + ) + } + + } + + test("sarscov2_bed_tbi_stub") { + config "./tabix_tbi.config" + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test' ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/bed/test.bed', checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + { assert snapshot( + file(process.out.gz_tbi[0][1]).name + ).match("tbi_stub") + } + ) + } + + } + +} diff --git a/modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap b/modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap new file mode 100644 index 00000000..fb87799b --- /dev/null +++ b/modules/nf-core/tabix/bgziptabix/tests/main.nf.test.snap @@ -0,0 +1,206 @@ +{ + "sarscov2_bed_tbi": { + "content": [ + { + "0": [ + [ + { + "id": "tbi_test" + }, + "tbi_test.bed.gz:md5,fe4053cf4de3aebbdfc3be2efb125a74", + "tbi_test.bed.gz.tbi:md5,ca06caf88b1e3c67d5fcba0a1460b52c" + ] + ], + "1": [ + + ], + "2": [ + "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + ], + "gz_csi": [ + + ], + "gz_tbi": [ + [ + { + "id": "tbi_test" + }, + "tbi_test.bed.gz:md5,fe4053cf4de3aebbdfc3be2efb125a74", + "tbi_test.bed.gz.tbi:md5,ca06caf88b1e3c67d5fcba0a1460b52c" + ] + ], + "versions": [ + "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-19T11:29:16.053817543" + }, + "sarscov2_bed_csi": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "csi_test" + }, + "csi_test.bed.gz:md5,fe4053cf4de3aebbdfc3be2efb125a74", + "csi_test.bed.gz.csi:md5,c9c0377de58fdc89672bb3005a0d69f5" + ] + ], + "2": [ + "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + ], + "gz_csi": [ + [ + { + "id": "csi_test" + }, + "csi_test.bed.gz:md5,fe4053cf4de3aebbdfc3be2efb125a74", + "csi_test.bed.gz.csi:md5,c9c0377de58fdc89672bb3005a0d69f5" + ] + ], + "gz_tbi": [ + + ], + "versions": [ + "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-19T11:29:27.667745444" + }, + "csi_test": { + "content": [ + "csi_test.bed.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-02-19T14:51:00.548801" + }, + "sarscov2_bed_tbi_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.bed.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + ], + "gz_csi": [ + + ], + "gz_tbi": [ + [ + { + "id": "test" + }, + "test.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.bed.gz.tbi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-25T14:45:18.533169949" + }, + "csi_stub": { + "content": [ + "test.bed.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-02-19T14:51:09.218454" + }, + "tbi_stub": { + "content": [ + "test.bed.gz" + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-25T14:45:18.550930179" + }, + "tbi_test": { + "content": [ + "tbi_test.bed.gz" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-02-19T14:50:51.579654" + }, + "sarscov2_bed_csi_stub": { + "content": [ + { + "0": [ + + ], + "1": [ + [ + { + "id": "test" + }, + "test.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + ], + "gz_csi": [ + [ + { + "id": "test" + }, + "test.bed.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test.bed.gz.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "gz_tbi": [ + + ], + "versions": [ + "versions.yml:md5,736e7c3b16a3ac525253e5b5f5d8fdfa" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-09-25T14:44:19.786135972" + } +} \ No newline at end of file diff --git a/modules/nf-core/tabix/bgziptabix/tests/tabix_csi.config b/modules/nf-core/tabix/bgziptabix/tests/tabix_csi.config new file mode 100644 index 00000000..fb41a314 --- /dev/null +++ b/modules/nf-core/tabix/bgziptabix/tests/tabix_csi.config @@ -0,0 +1,5 @@ +process { + withName: TABIX_BGZIPTABIX { + ext.args2 = '-p vcf --csi' + } +} diff --git a/modules/nf-core/tabix/bgziptabix/tests/tabix_tbi.config b/modules/nf-core/tabix/bgziptabix/tests/tabix_tbi.config new file mode 100644 index 00000000..c1915dc4 --- /dev/null +++ b/modules/nf-core/tabix/bgziptabix/tests/tabix_tbi.config @@ -0,0 +1,5 @@ +process { + withName: TABIX_BGZIPTABIX { + ext.args2 = '-p vcf' + } +} \ No newline at end of file diff --git a/modules/nf-core/tabix/bgziptabix/tests/tags.yml b/modules/nf-core/tabix/bgziptabix/tests/tags.yml new file mode 100644 index 00000000..5052b4d7 --- /dev/null +++ b/modules/nf-core/tabix/bgziptabix/tests/tags.yml @@ -0,0 +1,2 @@ +tabix/bgziptabix: + - "modules/nf-core/tabix/bgziptabix/**" diff --git a/modules/nf-core/windowmasker/mkcounts/tests/main.nf.test b/modules/nf-core/windowmasker/mkcounts/tests/main.nf.test new file mode 100644 index 00000000..bf53d7fa --- /dev/null +++ b/modules/nf-core/windowmasker/mkcounts/tests/main.nf.test @@ -0,0 +1,59 @@ +nextflow_process { + + name "Test Process WINDOWMASKER_MKCOUNTS" + script "../main.nf" + process "WINDOWMASKER_MKCOUNTS" + + tag "modules" + tag "modules_nfcore" + tag "windowmasker" + tag "windowmasker/mkcounts" + + test("sarscov2_fasta") { + + when { + params { + // define parameters here. Example: + // outdir = "tests/results" + } + process { + """ + input[0] = [ + [id: "test" ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + test("sarscov2_fasta_stub") { + + options '-stub' + + when { + process { + """ + input[0] = [ + [id: "test" ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + ] + """ + } + } + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + +} diff --git a/modules/nf-core/windowmasker/mkcounts/tests/main.nf.test.snap b/modules/nf-core/windowmasker/mkcounts/tests/main.nf.test.snap new file mode 100644 index 00000000..cae2d306 --- /dev/null +++ b/modules/nf-core/windowmasker/mkcounts/tests/main.nf.test.snap @@ -0,0 +1,60 @@ +{ + "sarscov2_fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.txt:md5,5f5d7e926fdf13b0c57651f962cc1253" + ] + ], + "1": [ + "versions.yml:md5,57ae356f69298e25eb5d070900865cf2" + ], + "counts": [ + [ + { + "id": "test" + }, + "test.txt:md5,5f5d7e926fdf13b0c57651f962cc1253" + ] + ], + "versions": [ + "versions.yml:md5,57ae356f69298e25eb5d070900865cf2" + ] + } + ], + "timestamp": "2024-02-15T13:29:58.837482" + }, + "sarscov2_fasta_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,57ae356f69298e25eb5d070900865cf2" + ], + "counts": [ + [ + { + "id": "test" + }, + "test.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,57ae356f69298e25eb5d070900865cf2" + ] + } + ], + "timestamp": "2024-02-15T13:30:07.618636" + } +} \ No newline at end of file diff --git a/modules/nf-core/windowmasker/mkcounts/tests/nextflow.config b/modules/nf-core/windowmasker/mkcounts/tests/nextflow.config new file mode 100644 index 00000000..65fc1910 --- /dev/null +++ b/modules/nf-core/windowmasker/mkcounts/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: WINDOWMASKER_MKCOUNTS { + ext.args = "" + } +} \ No newline at end of file diff --git a/modules/nf-core/windowmasker/mkcounts/tests/tags.yml b/modules/nf-core/windowmasker/mkcounts/tests/tags.yml new file mode 100644 index 00000000..95c67635 --- /dev/null +++ b/modules/nf-core/windowmasker/mkcounts/tests/tags.yml @@ -0,0 +1,2 @@ +windowmasker/mkcounts: + - "modules/nf-core/windowmasker/mkcounts/**" diff --git a/modules/nf-core/windowmasker/ustat/tests/main.nf.test b/modules/nf-core/windowmasker/ustat/tests/main.nf.test new file mode 100644 index 00000000..6e02c9c1 --- /dev/null +++ b/modules/nf-core/windowmasker/ustat/tests/main.nf.test @@ -0,0 +1,66 @@ +nextflow_process { + + name "Test Process WINDOWMASKER_USTAT" + script "../main.nf" + process "WINDOWMASKER_USTAT" + config "./nextflow.config" + + tag "modules" + tag "modules_nfcore" + tag "windowmasker" + tag "windowmasker/ustat" + tag "windowmasker/mkcounts" + + + setup { + run("WINDOWMASKER_MKCOUNTS") { + script "../../mkcounts/main.nf" + process { + """ + input[0] = [ + [id: "test" ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + ] + """ + } + } + } + + test("sarscov2_fasta") { + when { + process { + """ + input[0] = WINDOWMASKER_MKCOUNTS.out.counts + input[1] = [ + [id: "test" ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + ] + """ + } + } + then { + assert process.success + assert snapshot(process.out).match() + } + } + + test("sarscov2_fasta_stub") { + when { + process { + """ + input[0] = WINDOWMASKER_MKCOUNTS.out.counts + input[1] = [ + [id: "test" ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + ] + """ + } + } + then { + assert process.success + assert snapshot(process.out).match() + } + + } + +} diff --git a/modules/nf-core/windowmasker/ustat/tests/main.nf.test.snap b/modules/nf-core/windowmasker/ustat/tests/main.nf.test.snap new file mode 100644 index 00000000..79d3d82d --- /dev/null +++ b/modules/nf-core/windowmasker/ustat/tests/main.nf.test.snap @@ -0,0 +1,60 @@ +{ + "sarscov2_fasta": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.interval:md5,c91346601564ab88cbb0f913881d05e2" + ] + ], + "1": [ + "versions.yml:md5,d43f04bb181ac80da9ec79d9b49131cf" + ], + "intervals": [ + [ + { + "id": "test" + }, + "test.interval:md5,c91346601564ab88cbb0f913881d05e2" + ] + ], + "versions": [ + "versions.yml:md5,d43f04bb181ac80da9ec79d9b49131cf" + ] + } + ], + "timestamp": "2024-02-15T14:19:12.033774" + }, + "sarscov2_fasta_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.interval:md5,c91346601564ab88cbb0f913881d05e2" + ] + ], + "1": [ + "versions.yml:md5,d43f04bb181ac80da9ec79d9b49131cf" + ], + "intervals": [ + [ + { + "id": "test" + }, + "test.interval:md5,c91346601564ab88cbb0f913881d05e2" + ] + ], + "versions": [ + "versions.yml:md5,d43f04bb181ac80da9ec79d9b49131cf" + ] + } + ], + "timestamp": "2024-02-15T14:19:21.850526" + } +} \ No newline at end of file diff --git a/modules/nf-core/windowmasker/ustat/tests/nextflow.config b/modules/nf-core/windowmasker/ustat/tests/nextflow.config new file mode 100644 index 00000000..00b63c45 --- /dev/null +++ b/modules/nf-core/windowmasker/ustat/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'test_windowmasker_ustat:WINDOWMASKER_USTAT' { + ext.args = "-dust true -outfmt interval" + } +} \ No newline at end of file diff --git a/modules/nf-core/windowmasker/ustat/tests/tags.yml b/modules/nf-core/windowmasker/ustat/tests/tags.yml new file mode 100644 index 00000000..28c74ca9 --- /dev/null +++ b/modules/nf-core/windowmasker/ustat/tests/tags.yml @@ -0,0 +1,2 @@ +windowmasker/ustat: + - "modules/nf-core/windowmasker/ustat/**" From dc1e076da9c0d751fb62ca6c74051f935f8026dc Mon Sep 17 00:00:00 2001 From: DLBPointon Date: Wed, 20 Nov 2024 14:39:03 +0000 Subject: [PATCH 03/10] Updating all easy to update modules --- modules/nf-core/busco/busco/environment.yml | 5 + modules/nf-core/busco/busco/main.nf | 107 ++++++++++++++ modules/nf-core/busco/busco/meta.yml | 152 ++++++++++++++++++++ 3 files changed, 264 insertions(+) create mode 100644 modules/nf-core/busco/busco/environment.yml create mode 100644 modules/nf-core/busco/busco/main.nf create mode 100644 modules/nf-core/busco/busco/meta.yml diff --git a/modules/nf-core/busco/busco/environment.yml b/modules/nf-core/busco/busco/environment.yml new file mode 100644 index 00000000..5b918b45 --- /dev/null +++ b/modules/nf-core/busco/busco/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::busco=5.7.1 diff --git a/modules/nf-core/busco/busco/main.nf b/modules/nf-core/busco/busco/main.nf new file mode 100644 index 00000000..f7c1a662 --- /dev/null +++ b/modules/nf-core/busco/busco/main.nf @@ -0,0 +1,107 @@ +process BUSCO_BUSCO { + tag "$meta.id" + label 'process_medium' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/busco:5.7.1--pyhdfd78af_0': + 'biocontainers/busco:5.7.1--pyhdfd78af_0' }" + + input: + tuple val(meta), path(fasta, stageAs:'tmp_input/*') + val mode // Required: One of genome, proteins, or transcriptome + val lineage // Required: lineage to check against, "auto" enables --auto-lineage instead + path busco_lineages_path // Recommended: path to busco lineages - downloads if not set + path config_file // Optional: busco configuration file + + output: + tuple val(meta), path("*-busco.batch_summary.txt") , emit: batch_summary + tuple val(meta), path("short_summary.*.txt") , emit: short_summaries_txt , optional: true + tuple val(meta), path("short_summary.*.json") , emit: short_summaries_json , optional: true + tuple val(meta), path("*-busco/*/run_*/full_table.tsv") , emit: full_table , optional: true + tuple val(meta), path("*-busco/*/run_*/missing_busco_list.tsv") , emit: missing_busco_list , optional: true + tuple val(meta), path("*-busco/*/run_*/single_copy_proteins.faa") , emit: single_copy_proteins , optional: true + tuple val(meta), path("*-busco/*/run_*/busco_sequences") , emit: seq_dir + tuple val(meta), path("*-busco/*/translated_proteins") , emit: translated_dir , optional: true + tuple val(meta), path("*-busco") , emit: busco_dir + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + if ( mode !in [ 'genome', 'proteins', 'transcriptome' ] ) { + error "Mode must be one of 'genome', 'proteins', or 'transcriptome'." + } + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}-${lineage}" + def busco_config = config_file ? "--config $config_file" : '' + def busco_lineage = lineage.equals('auto') ? '--auto-lineage' : "--lineage_dataset ${lineage}" + def busco_lineage_dir = busco_lineages_path ? "--download_path ${busco_lineages_path}" : '' + """ + # Nextflow changes the container --entrypoint to /bin/bash (container default entrypoint: /usr/local/env-execute) + # Check for container variable initialisation script and source it. + if [ -f "/usr/local/env-activate.sh" ]; then + set +u # Otherwise, errors out because of various unbound variables + . "/usr/local/env-activate.sh" + set -u + fi + + # If the augustus config directory is not writable, then copy to writeable area + if [ ! -w "\${AUGUSTUS_CONFIG_PATH}" ]; then + # Create writable tmp directory for augustus + AUG_CONF_DIR=\$( mktemp -d -p \$PWD ) + cp -r \$AUGUSTUS_CONFIG_PATH/* \$AUG_CONF_DIR + export AUGUSTUS_CONFIG_PATH=\$AUG_CONF_DIR + echo "New AUGUSTUS_CONFIG_PATH=\${AUGUSTUS_CONFIG_PATH}" + fi + + # Ensure the input is uncompressed + INPUT_SEQS=input_seqs + mkdir "\$INPUT_SEQS" + cd "\$INPUT_SEQS" + for FASTA in ../tmp_input/*; do + if [ "\${FASTA##*.}" == 'gz' ]; then + gzip -cdf "\$FASTA" > \$( basename "\$FASTA" .gz ) + else + ln -s "\$FASTA" . + fi + done + cd .. + + busco \\ + --cpu $task.cpus \\ + --in "\$INPUT_SEQS" \\ + --out ${prefix}-busco \\ + --mode $mode \\ + $busco_lineage \\ + $busco_lineage_dir \\ + $busco_config \\ + $args + + # clean up + rm -rf "\$INPUT_SEQS" + + # Move files to avoid staging/publishing issues + mv ${prefix}-busco/batch_summary.txt ${prefix}-busco.batch_summary.txt + mv ${prefix}-busco/*/short_summary.*.{json,txt} . || echo "Short summaries were not available: No genes were found." + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + busco: \$( busco --version 2>&1 | sed 's/^BUSCO //' ) + END_VERSIONS + """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}-${lineage}" + def fasta_name = files(fasta).first().name - '.gz' + """ + touch ${prefix}-busco.batch_summary.txt + mkdir -p ${prefix}-busco/$fasta_name/run_${lineage}/busco_sequences + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + busco: \$( busco --version 2>&1 | sed 's/^BUSCO //' ) + END_VERSIONS + """ +} diff --git a/modules/nf-core/busco/busco/meta.yml b/modules/nf-core/busco/busco/meta.yml new file mode 100644 index 00000000..7cb6d69c --- /dev/null +++ b/modules/nf-core/busco/busco/meta.yml @@ -0,0 +1,152 @@ +name: busco_busco +description: Benchmarking Universal Single Copy Orthologs +keywords: + - quality control + - genome + - transcriptome + - proteome +tools: + - busco: + description: BUSCO provides measures for quantitative assessment of genome assembly, + gene set, and transcriptome completeness based on evolutionarily informed expectations + of gene content from near-universal single-copy orthologs selected from OrthoDB. + homepage: https://busco.ezlab.org/ + documentation: https://busco.ezlab.org/busco_userguide.html + tool_dev_url: https://gitlab.com/ezlab/busco + doi: "10.1007/978-1-4939-9173-0_14" + licence: ["MIT"] + identifier: biotools:busco +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Nucleic or amino acid sequence file in FASTA format. + pattern: "*.{fasta,fna,fa,fasta.gz,fna.gz,fa.gz}" + - - mode: + type: string + description: The mode to run Busco in. One of genome, proteins, or transcriptome + pattern: "{genome,proteins,transcriptome}" + - - lineage: + type: string + description: The BUSCO lineage to use, or "auto" to automatically select lineage + - - busco_lineages_path: + type: directory + description: Path to local BUSCO lineages directory. + - - config_file: + type: file + description: Path to BUSCO config file. +output: + - batch_summary: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco.batch_summary.txt": + type: file + description: Summary of all sequence files analyzed + pattern: "*-busco.batch_summary.txt" + - short_summaries_txt: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - short_summary.*.txt: + type: file + description: Short Busco summary in plain text format + pattern: "short_summary.*.txt" + - short_summaries_json: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - short_summary.*.json: + type: file + description: Short Busco summary in JSON format + pattern: "short_summary.*.json" + - full_table: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco/*/run_*/full_table.tsv": + type: file + description: Full BUSCO results table + pattern: "full_table.tsv" + - missing_busco_list: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco/*/run_*/missing_busco_list.tsv": + type: file + description: List of missing BUSCOs + pattern: "missing_busco_list.tsv" + - single_copy_proteins: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco/*/run_*/single_copy_proteins.faa": + type: file + description: Fasta file of single copy proteins (transcriptome mode) + pattern: "single_copy_proteins.faa" + - seq_dir: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco/*/run_*/busco_sequences": + type: directory + description: BUSCO sequence directory + pattern: "busco_sequences" + - translated_dir: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco/*/translated_proteins": + type: directory + description: Six frame translations of each transcript made by the transcriptome + mode + pattern: "translated_dir" + - busco_dir: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*-busco": + type: directory + description: BUSCO lineage specific output + pattern: "*-busco" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@priyanka-surana" + - "@charles-plessy" + - "@mahesh-panchal" + - "@muffato" + - "@jvhagey" + - "@gallvp" +maintainers: + - "@priyanka-surana" + - "@charles-plessy" + - "@mahesh-panchal" + - "@muffato" + - "@jvhagey" + - "@gallvp" From 3c660bb86ee98bf5b4a1ea4db76f3b1f5750d597 Mon Sep 17 00:00:00 2001 From: DLBPointon Date: Wed, 20 Nov 2024 14:39:35 +0000 Subject: [PATCH 04/10] Updating all easy to update modules --- .../nf-core/miniprot/index/environment.yml | 5 + modules/nf-core/pretextmap/environment.yml | 6 + modules/nf-core/pretextmap/tests/main.nf.test | 148 +++++++++++++++++ .../pretextmap/tests/main.nf.test.snap | 157 ++++++++++++++++++ modules/nf-core/pretextmap/tests/tags.yml | 2 + .../nf-core/pretextsnapshot/environment.yml | 5 + .../nf-core/ucsc/bedtobigbed/environment.yml | 5 + 7 files changed, 328 insertions(+) create mode 100644 modules/nf-core/miniprot/index/environment.yml create mode 100644 modules/nf-core/pretextmap/environment.yml create mode 100644 modules/nf-core/pretextmap/tests/main.nf.test create mode 100644 modules/nf-core/pretextmap/tests/main.nf.test.snap create mode 100644 modules/nf-core/pretextmap/tests/tags.yml create mode 100644 modules/nf-core/pretextsnapshot/environment.yml create mode 100644 modules/nf-core/ucsc/bedtobigbed/environment.yml diff --git a/modules/nf-core/miniprot/index/environment.yml b/modules/nf-core/miniprot/index/environment.yml new file mode 100644 index 00000000..7e258a04 --- /dev/null +++ b/modules/nf-core/miniprot/index/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::miniprot=0.11=he4a0461_2 diff --git a/modules/nf-core/pretextmap/environment.yml b/modules/nf-core/pretextmap/environment.yml new file mode 100644 index 00000000..bfbbee2b --- /dev/null +++ b/modules/nf-core/pretextmap/environment.yml @@ -0,0 +1,6 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::pretextmap=0.1.9 + - bioconda::samtools=1.17 diff --git a/modules/nf-core/pretextmap/tests/main.nf.test b/modules/nf-core/pretextmap/tests/main.nf.test new file mode 100644 index 00000000..cd2c3919 --- /dev/null +++ b/modules/nf-core/pretextmap/tests/main.nf.test @@ -0,0 +1,148 @@ +nextflow_process { + + name "Test Process PRETEXTMAP" + script "../main.nf" + process "PRETEXTMAP" + + tag "modules" + tag "modules_nfcore" + tag "pretext" + tag "pretextmap" + + test("homo_cram_map") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ] + + input[1] = [ + [ id: 'test2', single_end: false ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_cram_map_nofai") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ] + + input[1] = [ + [ id: 'test2', single_end: false ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true), + [] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_bam_map") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ] + + input[1] = [ + [ id: 'test2', single_end: false ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta.fai', checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("mapped_pairs_map") { + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file("https://raw.githubusercontent.com/4dn-dcic/pairix/master/samples/test_4dn.pairs.gz", checkIfExists: true) + ] + + input[1] = [ + [], + [], + [] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("homo_cram_map_stub") { + options "-stub" + when { + process { + """ + input[0] = [ + [ id:'test', single_end: false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ] + + input[1] = [ + [ id: 'test2', single_end: false ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/chr21/sequence/genome.fasta.fai', checkIfExists: true) + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/pretextmap/tests/main.nf.test.snap b/modules/nf-core/pretextmap/tests/main.nf.test.snap new file mode 100644 index 00000000..48697af8 --- /dev/null +++ b/modules/nf-core/pretextmap/tests/main.nf.test.snap @@ -0,0 +1,157 @@ +{ + "homo_cram_map": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.pretext:md5,ae0f18b472e39de970fdc1aebc0f3f8d" + ] + ], + "1": [ + "versions.yml:md5,894afb81509c847f7d9a58885e086b5c" + ], + "pretext": [ + [ + { + "id": "test", + "single_end": false + }, + "test.pretext:md5,ae0f18b472e39de970fdc1aebc0f3f8d" + ] + ], + "versions": [ + "versions.yml:md5,894afb81509c847f7d9a58885e086b5c" + ] + } + ], + "timestamp": "2024-03-21T10:53:43.322902" + }, + "homo_cram_map_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.pretext:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,894afb81509c847f7d9a58885e086b5c" + ], + "pretext": [ + [ + { + "id": "test", + "single_end": false + }, + "test.pretext:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,894afb81509c847f7d9a58885e086b5c" + ] + } + ], + "timestamp": "2024-03-21T11:07:44.32508" + }, + "homo_cram_map_nofai": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.pretext:md5,ae0f18b472e39de970fdc1aebc0f3f8d" + ] + ], + "1": [ + "versions.yml:md5,894afb81509c847f7d9a58885e086b5c" + ], + "pretext": [ + [ + { + "id": "test", + "single_end": false + }, + "test.pretext:md5,ae0f18b472e39de970fdc1aebc0f3f8d" + ] + ], + "versions": [ + "versions.yml:md5,894afb81509c847f7d9a58885e086b5c" + ] + } + ], + "timestamp": "2024-03-21T10:58:16.804287" + }, + "mapped_pairs_map": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.pretext:md5,b47be7fd285a2de68643f73f85ba84f1" + ] + ], + "1": [ + "versions.yml:md5,894afb81509c847f7d9a58885e086b5c" + ], + "pretext": [ + [ + { + "id": "test", + "single_end": false + }, + "test.pretext:md5,b47be7fd285a2de68643f73f85ba84f1" + ] + ], + "versions": [ + "versions.yml:md5,894afb81509c847f7d9a58885e086b5c" + ] + } + ], + "timestamp": "2024-03-21T11:07:32.047007" + }, + "homo_bam_map": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.pretext:md5,ae0f18b472e39de970fdc1aebc0f3f8d" + ] + ], + "1": [ + "versions.yml:md5,894afb81509c847f7d9a58885e086b5c" + ], + "pretext": [ + [ + { + "id": "test", + "single_end": false + }, + "test.pretext:md5,ae0f18b472e39de970fdc1aebc0f3f8d" + ] + ], + "versions": [ + "versions.yml:md5,894afb81509c847f7d9a58885e086b5c" + ] + } + ], + "timestamp": "2024-03-21T11:02:50.120033" + } +} \ No newline at end of file diff --git a/modules/nf-core/pretextmap/tests/tags.yml b/modules/nf-core/pretextmap/tests/tags.yml new file mode 100644 index 00000000..70f7eefc --- /dev/null +++ b/modules/nf-core/pretextmap/tests/tags.yml @@ -0,0 +1,2 @@ +pretextmap: + - "modules/nf-core/pretextmap/**" diff --git a/modules/nf-core/pretextsnapshot/environment.yml b/modules/nf-core/pretextsnapshot/environment.yml new file mode 100644 index 00000000..ed721522 --- /dev/null +++ b/modules/nf-core/pretextsnapshot/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::pretextsnapshot=0.0.4 diff --git a/modules/nf-core/ucsc/bedtobigbed/environment.yml b/modules/nf-core/ucsc/bedtobigbed/environment.yml new file mode 100644 index 00000000..62670c4e --- /dev/null +++ b/modules/nf-core/ucsc/bedtobigbed/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::ucsc-bedtobigbed=447 From 32152a5366b4d3051ce3f74d0f8bbff738ce5691 Mon Sep 17 00:00:00 2001 From: DLBPointon Date: Wed, 20 Nov 2024 16:09:39 +0000 Subject: [PATCH 05/10] Fixes to modules --- modules/nf-core/pretextsnapshot/main.nf | 3 ++- modules/nf-core/pretextsnapshot/pretextsnapshot.diff | 12 +----------- 2 files changed, 3 insertions(+), 12 deletions(-) diff --git a/modules/nf-core/pretextsnapshot/main.nf b/modules/nf-core/pretextsnapshot/main.nf index 39d72c74..5524785d 100644 --- a/modules/nf-core/pretextsnapshot/main.nf +++ b/modules/nf-core/pretextsnapshot/main.nf @@ -4,7 +4,8 @@ process PRETEXTSNAPSHOT { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : 'docker.io/ubuntu:20.04' }" + 'https://depot.galaxyproject.org/singularity/pretextsnapshot:0.0.4--h7d875b9_0': + 'biocontainers/pretextsnapshot:0.0.4--h7d875b9_0' }" input: tuple val(meta), path(pretext_map) diff --git a/modules/nf-core/pretextsnapshot/pretextsnapshot.diff b/modules/nf-core/pretextsnapshot/pretextsnapshot.diff index edd414d5..4759c3ae 100644 --- a/modules/nf-core/pretextsnapshot/pretextsnapshot.diff +++ b/modules/nf-core/pretextsnapshot/pretextsnapshot.diff @@ -3,17 +3,7 @@ Changes in module 'nf-core/pretextsnapshot' Changes in 'pretextsnapshot/main.nf': --- modules/nf-core/pretextsnapshot/main.nf +++ modules/nf-core/pretextsnapshot/main.nf -@@ -4,8 +4,7 @@ - - conda "${moduleDir}/environment.yml" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? -- 'https://depot.galaxyproject.org/singularity/pretextsnapshot:0.0.4--h7d875b9_0': -- 'biocontainers/pretextsnapshot:0.0.4--h7d875b9_0' }" -+ 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : 'docker.io/ubuntu:20.04' }" - - input: - tuple val(meta), path(pretext_map) -@@ -18,18 +17,31 @@ +@@ -18,18 +18,31 @@ task.ext.when == null || task.ext.when script: From 1beeeb5f25ec97b611485cf141ab1f45b85cdf46 Mon Sep 17 00:00:00 2001 From: DLBPointon Date: Wed, 20 Nov 2024 16:26:49 +0000 Subject: [PATCH 06/10] linting --- modules.json | 150 +++++++++++++-------------------------------------- 1 file changed, 38 insertions(+), 112 deletions(-) diff --git a/modules.json b/modules.json index 36502544..1296f7df 100755 --- a/modules.json +++ b/modules.json @@ -8,266 +8,192 @@ "bedtools/bamtobed": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/genomecov": { "branch": "master", "git_sha": "575e1bc54b083fb15e7dd8b5fcc40bea60e8ce83", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/intersect": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/makewindows": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/map": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/merge": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/sort": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "busco/busco": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bwamem2/index": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "cat/cat": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "cooler/cload": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "cooler/zoomify": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "custom/dumpsoftwareversions": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "custom/getchromsizes": { "branch": "master", "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/custom/getchromsizes/custom-getchromsizes.diff" }, "fastk/fastk": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "gnu/sort": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "merquryfk/merquryfk": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "minimap2/align": { "branch": "master", "git_sha": "603ecbd9f45300c9788f197d2a15a005685b4220", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/minimap2/align/minimap2-align.diff" }, "minimap2/index": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "miniprot/align": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "miniprot/index": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "mummer": { "branch": "master", "git_sha": "9e51255c4f8ec69fb6ccf68593392835f14fecb8", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/mummer/mummer.diff" }, "paftools/sam2paf": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "pretextmap": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/pretextmap/pretextmap.diff" }, "pretextsnapshot": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/pretextsnapshot/pretextsnapshot.diff" }, "samtools/faidx": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/index": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/markdup": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/merge": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/sort": { "branch": "master", "git_sha": "b7800db9b069ed505db3f9d91b8c72faea9be17b", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/view": { "branch": "master", "git_sha": "669eb24fd82a9d3cb18ad0e73673ecb26827f683", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "seqtk/cutn": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "tabix/bgziptabix": { "branch": "master", "git_sha": "f448e846bdadd80fc8be31fbbc78d9f5b5131a45", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "ucsc/bedgraphtobigwig": { "branch": "master", "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "ucsc/bedtobigbed": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "windowmasker/mkcounts": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "windowmasker/ustat": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] } } }, @@ -276,4 +202,4 @@ } } } -} \ No newline at end of file +} From 4ad0c6562714bab53c0d2b151f4c8d7f3ec40ca1 Mon Sep 17 00:00:00 2001 From: DLBPointon Date: Thu, 21 Nov 2024 12:55:46 +0000 Subject: [PATCH 07/10] Adding steps to skip BUSCO --- .github/workflows/ci.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index c379c507..d1984149 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -72,4 +72,4 @@ jobs: - name: Singularity - Run FULL pipeline with test data # Remember that you can parallelise this by using strategy.matrix run: | - nextflow run ./sanger-treeval/${{ steps.branch-names.outputs.current_branch }}/main.nf -profile test_github,singularity --outdir ./Sing-Full + nextflow run ./sanger-treeval/${{ steps.branch-names.outputs.current_branch }}/main.nf -profile test_github,singularity --outdir ./Sing-Full --steps busco From 160af01e83a47f1678b1674a789bcf3fb90c7951 Mon Sep 17 00:00:00 2001 From: DLBPointon Date: Thu, 21 Nov 2024 13:46:55 +0000 Subject: [PATCH 08/10] Pinning BUSCO to V5.5 --- modules.json | 151 ++++++++++++++----- modules/nf-core/busco/busco/busco-busco.diff | 26 ++++ modules/nf-core/busco/busco/main.nf | 4 +- 3 files changed, 141 insertions(+), 40 deletions(-) create mode 100644 modules/nf-core/busco/busco/busco-busco.diff diff --git a/modules.json b/modules.json index 1296f7df..54fd8a8a 100755 --- a/modules.json +++ b/modules.json @@ -8,192 +8,267 @@ "bedtools/bamtobed": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/genomecov": { "branch": "master", "git_sha": "575e1bc54b083fb15e7dd8b5fcc40bea60e8ce83", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/intersect": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/makewindows": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/map": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/merge": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "bedtools/sort": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "busco/busco": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ], + "patch": "modules/nf-core/busco/busco/busco-busco.diff" }, "bwamem2/index": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "cat/cat": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "cooler/cload": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "cooler/zoomify": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "custom/dumpsoftwareversions": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "custom/getchromsizes": { "branch": "master", "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358", - "installed_by": ["modules"], + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/custom/getchromsizes/custom-getchromsizes.diff" }, "fastk/fastk": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "gnu/sort": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "merquryfk/merquryfk": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "minimap2/align": { "branch": "master", "git_sha": "603ecbd9f45300c9788f197d2a15a005685b4220", - "installed_by": ["modules"], + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/minimap2/align/minimap2-align.diff" }, "minimap2/index": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "miniprot/align": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "miniprot/index": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "mummer": { "branch": "master", "git_sha": "9e51255c4f8ec69fb6ccf68593392835f14fecb8", - "installed_by": ["modules"], + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/mummer/mummer.diff" }, "paftools/sam2paf": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "pretextmap": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"], + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/pretextmap/pretextmap.diff" }, "pretextsnapshot": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"], + "installed_by": [ + "modules" + ], "patch": "modules/nf-core/pretextsnapshot/pretextsnapshot.diff" }, "samtools/faidx": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/index": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/markdup": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/merge": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/sort": { "branch": "master", "git_sha": "b7800db9b069ed505db3f9d91b8c72faea9be17b", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "samtools/view": { "branch": "master", "git_sha": "669eb24fd82a9d3cb18ad0e73673ecb26827f683", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "seqtk/cutn": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "tabix/bgziptabix": { "branch": "master", "git_sha": "f448e846bdadd80fc8be31fbbc78d9f5b5131a45", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "ucsc/bedgraphtobigwig": { "branch": "master", "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "ucsc/bedtobigbed": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "windowmasker/mkcounts": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] }, "windowmasker/ustat": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": ["modules"] + "installed_by": [ + "modules" + ] } } }, @@ -202,4 +277,4 @@ } } } -} +} \ No newline at end of file diff --git a/modules/nf-core/busco/busco/busco-busco.diff b/modules/nf-core/busco/busco/busco-busco.diff new file mode 100644 index 00000000..ea0a471b --- /dev/null +++ b/modules/nf-core/busco/busco/busco-busco.diff @@ -0,0 +1,26 @@ +Changes in module 'nf-core/busco/busco' +'modules/nf-core/busco/busco/meta.yml' is unchanged +Changes in 'busco/busco/main.nf': +--- modules/nf-core/busco/busco/main.nf ++++ modules/nf-core/busco/busco/main.nf +@@ -4,8 +4,8 @@ + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? +- 'https://depot.galaxyproject.org/singularity/busco:5.7.1--pyhdfd78af_0': +- 'biocontainers/busco:5.7.1--pyhdfd78af_0' }" ++ 'https://depot.galaxyproject.org/singularity/busco:5.5.0--pyhdfd78af_0': ++ 'biocontainers/busco:5.5.0--pyhdfd78af_0' }" + + input: + tuple val(meta), path(fasta, stageAs:'tmp_input/*') + +'modules/nf-core/busco/busco/environment.yml' is unchanged +'modules/nf-core/busco/busco/tests/old_test.yml' is unchanged +'modules/nf-core/busco/busco/tests/nextflow.augustus.config' is unchanged +'modules/nf-core/busco/busco/tests/main.nf.test' is unchanged +'modules/nf-core/busco/busco/tests/tags.yml' is unchanged +'modules/nf-core/busco/busco/tests/nextflow.config' is unchanged +'modules/nf-core/busco/busco/tests/main.nf.test.snap' is unchanged +'modules/nf-core/busco/busco/tests/nextflow.metaeuk.config' is unchanged +************************************************************ diff --git a/modules/nf-core/busco/busco/main.nf b/modules/nf-core/busco/busco/main.nf index f7c1a662..f5650847 100644 --- a/modules/nf-core/busco/busco/main.nf +++ b/modules/nf-core/busco/busco/main.nf @@ -4,8 +4,8 @@ process BUSCO_BUSCO { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/busco:5.7.1--pyhdfd78af_0': - 'biocontainers/busco:5.7.1--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/busco:5.5.0--pyhdfd78af_0': + 'biocontainers/busco:5.5.0--pyhdfd78af_0' }" input: tuple val(meta), path(fasta, stageAs:'tmp_input/*') From 55ed6d6d293600ad1ec48244d9a374d195a97bf7 Mon Sep 17 00:00:00 2001 From: DLBPointon Date: Thu, 21 Nov 2024 13:47:15 +0000 Subject: [PATCH 09/10] Removing steps var --- .github/workflows/ci.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index d1984149..c379c507 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -72,4 +72,4 @@ jobs: - name: Singularity - Run FULL pipeline with test data # Remember that you can parallelise this by using strategy.matrix run: | - nextflow run ./sanger-treeval/${{ steps.branch-names.outputs.current_branch }}/main.nf -profile test_github,singularity --outdir ./Sing-Full --steps busco + nextflow run ./sanger-treeval/${{ steps.branch-names.outputs.current_branch }}/main.nf -profile test_github,singularity --outdir ./Sing-Full From 0ada598675f400f0587b9f0390bcc6190e5fa6af Mon Sep 17 00:00:00 2001 From: DLBPointon Date: Thu, 21 Nov 2024 14:36:57 +0000 Subject: [PATCH 10/10] Linting --- modules.json | 150 +++++++++++++-------------------------------------- 1 file changed, 38 insertions(+), 112 deletions(-) diff --git a/modules.json b/modules.json index 54fd8a8a..adc156f3 100755 --- a/modules.json +++ b/modules.json @@ -8,267 +8,193 @@ "bedtools/bamtobed": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/genomecov": { "branch": "master", "git_sha": "575e1bc54b083fb15e7dd8b5fcc40bea60e8ce83", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/intersect": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/makewindows": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/map": { "branch": "master", "git_sha": "3b248b84694d1939ac4bb33df84bf6233a34d668", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/merge": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "bedtools/sort": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "busco/busco": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/busco/busco/busco-busco.diff" }, "bwamem2/index": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "cat/cat": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "cooler/cload": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "cooler/zoomify": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "custom/dumpsoftwareversions": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "custom/getchromsizes": { "branch": "master", "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/custom/getchromsizes/custom-getchromsizes.diff" }, "fastk/fastk": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "gnu/sort": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "merquryfk/merquryfk": { "branch": "master", "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "minimap2/align": { "branch": "master", "git_sha": "603ecbd9f45300c9788f197d2a15a005685b4220", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/minimap2/align/minimap2-align.diff" }, "minimap2/index": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "miniprot/align": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "miniprot/index": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "mummer": { "branch": "master", "git_sha": "9e51255c4f8ec69fb6ccf68593392835f14fecb8", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/mummer/mummer.diff" }, "paftools/sam2paf": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "pretextmap": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/pretextmap/pretextmap.diff" }, "pretextsnapshot": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ], + "installed_by": ["modules"], "patch": "modules/nf-core/pretextsnapshot/pretextsnapshot.diff" }, "samtools/faidx": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/index": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/markdup": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/merge": { "branch": "master", "git_sha": "b13f07be4c508d6ff6312d354d09f2493243e208", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/sort": { "branch": "master", "git_sha": "b7800db9b069ed505db3f9d91b8c72faea9be17b", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "samtools/view": { "branch": "master", "git_sha": "669eb24fd82a9d3cb18ad0e73673ecb26827f683", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "seqtk/cutn": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "tabix/bgziptabix": { "branch": "master", "git_sha": "f448e846bdadd80fc8be31fbbc78d9f5b5131a45", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "ucsc/bedgraphtobigwig": { "branch": "master", "git_sha": "49f4e50534fe4b64101e62ea41d5dc43b1324358", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "ucsc/bedtobigbed": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "windowmasker/mkcounts": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] }, "windowmasker/ustat": { "branch": "master", "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", - "installed_by": [ - "modules" - ] + "installed_by": ["modules"] } } }, @@ -277,4 +203,4 @@ } } } -} \ No newline at end of file +}