Merge branch 'master' of https://github.com/eternagame/EternaFold

README.md

@@ -11,19 +11,43 @@ EternaFold is possible thanks to [CONTRAfold-SE](https://github.com/csfoo/contra
 Clone the repository and run `make` in `src` to compile.
 Multithreaded version: run `make multi` in `src`.
 
+See instructions in [README_LinearFold-E_patch.md](README_LinearFold-E_patch.md) for using EternaFold parameters with LinearFold and LinearPartition algorithms.
+
 ### Prediction
 
 #### Single-structure prediction
-Predict the MEA structure of sequence "test", using the EternaFold parameters:
+Predict the MEA structure of example test sequence (Hammerhead ribozyme), using the EternaFold parameters:
 
-`contrafold predict test.bpseq --params parameters/EternaFoldParams.v1`
+`contrafold predict test.seq --params parameters/EternaFoldParams.v1`
 
-Please see the documentation of [CONTRAfold](http://contra.stanford.edu/contrafold/manual_v2_02.pdf) for further information on parameters and usage.
+Output:
+```
+Training mode: 
+Use constraints: 0
+Use evidence: 0
+Predicting using MEA estimator.
+>test.seq
+CGCUGUCUGUACUUGUAUCAGUACACUGACGAGUCCCUAAAGGACGAAACAGCG
+>structure
+(((((((((((((......))))))..)....((((.....))))...))))))
+```
 
-#### Fold change prediction
-Predict log K_MS2 values for riboswitch molecules to MS2 in the presence and absence of small molecule aptamers.
+Predict the ensemble free energy:
+
+```
+$ ./src/contrafold predict test.seq --params parameters/EternaFoldParams.v1 --partition
+```
+
+Output:
+```
+Training mode: 
+Use constraints: 0
+Use evidence: 0
+Log partition coefficient for "test.seq": 13.7489
+```
+
+Please see the documentation of [CONTRAfold](http://contra.stanford.edu/contrafold/manual_v2_02.pdf) for further information on parameters and usage. See below for documented discrepancies (besides parameters) from CONTRAfold codebases.
 
-`contrafold predict-foldchange test_ms2.bpseq`
 
 ### Training
 
@@ -87,3 +111,23 @@ k1.0 2.0 99
 3 U -1 19 19
 4 C -1 18 18
 ```
+
+#### ❗️ Discrepancies from CONTRAfold-SE code
+
+This code has been modified in two ways that means its output, even using the CONTRAfold parameters, will differ from the CONTRAfold codebase here and the CONTRAfold-SE codebase here.
+
+1. A bug was fixed in the multiloop traceback `InferenceEngine.ipp` which was first identified by He Zhang (Oregon State). 
+
+2. The minimum allowable hairpin size was increased from `0` to `3` to prevent structure predictions with `(())` hairpins. To revert back to the original CONTRAfold behavior, set `C_MIN_HP_LENGTH=0` in `Config.hpp` before compiling.
+
+Predictions for Hammerhead Ribozyme sequence, using default CONTRAfold parameters: `CGCUGUCUGUACUUGUAUCAGUACACUGACGAGUCCCUAAAGGACGAAACAGCG`
+
+contrafold predict hhr.bpseq --partition 
+
+| Version | hhr.bpseq Log Partition Coefficient |
+| --- | ----------- |
+|CONTRAfold v2.02| 6.87394|
+|CONTRAfold-SE| 6.87394|
+|EternaFold code, no ML fix and C_MIN_HP_LENGTH=0| 6.87394|
+|EternaFold code, C_MIN_HP_LENGTH=0| 6.83585|
+|EternaFold code | 6.77285 |

README_LinearFold-E_patch.md

@@ -2,16 +2,11 @@
 
 The EternaFold parameters have also been adapted for use with the LinearFold and LinearPartition algorithms, described in
 
-```
-LinearFold: Linear-Time Approximate RNA Folding by 5’-to-3’ Dynamic Programming and Beam Search. Bioinformatics, Volume 35, Issue 14, July 2019, Pages i295–i304. ISMB 2019
 
-Liang Huang, He Zhang, Dezhong Deng, Kai Zhao, Kaibo Liu, David Hendrix, David Mathews
-```
-```
-LinearPartition: linear-time approximation of RNA folding partition function and base-pairing probabilities. Bioinformatics, Volume 36, Issue Supplement_1, July 2020, Pages i258–i267. ISMB 2020
+Liang Huang, He Zhang, Dezhong Deng, Kai Zhao, Kaibo Liu, David Hendrix, David Mathews. *LinearFold: Linear-time approximate RNA folding by 5’-to-3’ dynamic programming and beam search.* Bioinformatics, Volume 35, Issue 14, July 2019, Pages i295–i304. ISMB 2019
+
+He Zhang, Liang Zhang, David Mathews, Liang Huang. *LinearPartition: Linear-time approximation of RNA folding partition function and base-pairing probabilities.* Bioinformatics, Volume 36, Issue Supplement_1, July 2020, Pages i258–i267. ISMB 2020
 
-He Zhang, Liang Zhang, David Mathews, Liang Huang
-```
 LinearFold and LinearPartition have different licenses than EternaFold, please read the LinearFold [license](https://github.com/LinearFold/LinearFold/blob/master/LICENSE) and LinearPartition [license](https://github.com/LinearFold/LinearPartition/blob/master/LICENSE) before proceeding.
 
 1. Clone the LinearFold repository at [https://github.com/LinearFold/LinearFold](https://github.com/LinearFold/LinearFold). The most recently-tested working commit is 260c6bbb9bf8cc84b807fa7633b9cb731e639884 (June 06 2021). You can get this commit with