-
Notifications
You must be signed in to change notification settings - Fork 47
New issue
Have a question about this project? # for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “#”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? # to your account
Improve cas9 documentation #259
Comments
Hi Manu, thought I would join in here and say that I'm sure how to use the CRISPR functions either. I have looked at the tests but I couldn't understand why the tests worked but my example here didn't. Could you please take a look if you have time? |
Hi @JeffXiePL, Yes, as mentioned before the crispr module is not very well documented yet. For documentation purposes (in case someone is interested / documents this in the hackathon),
I think that's roughly correct, but a great place to learn more about CRISPR is this AddGene post. As for pydna, the
Below is a minimal example for both cases: from pydna.dseqrecord import Dseqrecord
from pydna.crispr import cas9, protospacer
# <----protospacer---><-------scaffold----------------->
guide = "GTTACTTTACCCGACGTCCCgttttagagctagaaatagcaagttaaaataagg"
target = "GTTACTTTACCCGACGTCCCaGG"
# <->
# PAM
# Create an enzyme object with the protospacer
enzyme = cas9("GTTACTTTACCCGACGTCCC")
target_dseq = Dseqrecord(target)
# Cut using the enzyme
print('cutting with enzyme 1:', target_dseq.cut(enzyme))
# Get the protospacer from the full gRNA sequence
gRNA_protospacers = protospacer(Dseqrecord(guide), cas=cas9)
# Print the protospacer (it's a list because often plasmids contain multiple gRNAs)
print('protospacer:', gRNA_protospacers[0])
gRNA_protospacer = gRNA_protospacers[0]
# Create an enzyme from the protospacer
enzyme2 = cas9(gRNA_protospacer)
# Simulate the cut
print('cutting with enzyme 2:', target_dseq.cut(enzyme2))
# Note that without the PAM, the cut will not be made.
target_noPAM_dseq = Dseqrecord("GTTACTTTACCCGACGTCCCaaa")
print("cutting with no PAM in target:", target_noPAM_dseq.cut(enzyme2)) Hopefully this is useful for the hackathon |
Thank you so much for the detailed explanation! This makes a lot more sense now, and I'll work on the CRIPSR module in the upcoming days and the hackathon. |
I'm also planning on improving the CRISPR module functions and documentation! See #215 |
I'm down for working on this too :) |
* added new translation function * new orfs method for Seq based on three_frame_orfs function * new orfs_to_features method for Dseqrecord * new extract_from_text functions that also returns the intervening text between sequences * bugfix orfs for Seq and Dsecrecord * added crispr tests * added pairwise for older Python versions * older type hint * Deploying to gh-pages from @ da3e7e9 🚀 * Deploying to gh-pages from @ 5be4f9d 🚀 * Deploying to gh-pages from @ b37a17c 🚀 * Deploying to gh-pages from @ 11aae3c 🚀 * Deploying to gh-pages from @ 0f95223 🚀 * try to build docs locally on gh-pages * try to build gh pages * try to build gh pages * fix * added sphinx ext * Deploying to gh-pages from @ bc08a36 🚀 * try fix docs * build docs * clean * redirect docs badge to action * redirect docs badge to action * fix readme links * fix readme * fix * try to fix test error * fix bug that recognized parts of re enzyme names as other enzymes * added comment with number of enzymes * changed number of expected enzymes to the correct number 621 * more informative error msg * closes #216 (2) * closes #196 * vscode and poetry settings added * fix test * add locations_overlap to utils * Issue 238 (#239) * closes #238 * fix notebook * closes #240 * atomically write default config * optimisation for #237 * fix python 3.8 typing * include neb calculator and its tests * fix design and add tests * example commit for #176 * Documentation notebooks 2 (#272) * Documentation notebooks (#271) * added documentation for dseq.py * fixed docs for Dseq.py * fixed docs for Dseq.py * add hook * fix exclusions and run hook * strip outputs of Dseq.ipynb * update Dseq notebook * placed notebooks in docs * added looped and shifted methods in Dseq docs * added docs for importing files using pydna * added some Dseqrecord docs * added docs+examples for Dseq_Features * added origin spanning feats and removing feats for Dseq_Features * some comments and todos * added restriction page * updated Importing_Seq page * updated Dseq_Feature Page w/examples * added restrict+ligate notebook * added some PCR notes * added examples, prints * added tm and design * fixed tm_default docs * added gibson assembly * some comments on current progress * gibson * fixed comments, added gibson example and CRISPR * added Restriction example * added Gibson example * closes #256 * run pre-commit * alternative example for gibson * gibson updated example * modified crispr * modified crispr * feedback changes for #260 * best practices for qualifiers --------- Co-authored-by: Pei-Lun Xie <peilunx.jeff@gmail.com> Co-authored-by: Pei-Lun Xie <31442380+JeffXiePL@users.noreply.github.com> * remove unnecessary file * remove dir exclusions * exclude test notebooks --------- Co-authored-by: Pei-Lun Xie <peilunx.jeff@gmail.com> Co-authored-by: Pei-Lun Xie <31442380+JeffXiePL@users.noreply.github.com> * update contribution guidelines (#274) * update CI action to enforce hooks (#277) * update CI action to enforce hooks * update action * update: Added google badge to all notebooks issue #266 (#275) * fourth trt * final file added * update: added installation of pydna * added seguid stamp to Genbank sequence files * fix test sequence file * dependabot monthly * New CRISPR example notebook (#260) (#284) * fourth trt * final file added * update: added installation of pydna * update: added CRIPSR examples in notebooks issue #259 * update: added google badge issue #266 * Polished Example CRISPR notebook --------- Co-authored-by: Manuel Lera-Ramirez <manulera14@gmail.com> * Updated notebooks (#295) * updated example_restriction (#285) Co-authored-by: Pei-Lun Xie <peilunx.jeff@gmail.com> * small fixes (#294) * allow run all on notebooks that have pip install for google colab --------- Co-authored-by: Pei-Lun Xie <peilunx.jeff@gmail.com> * progress towards #261 * WIP * remove code image from README for #261 * more README updates + make requirements.txt * add requirements file * fix configuration * typing for PrettyTable * typing for codon dicts * typing for Seq * typing for FakeSeq * typing for Genbank * typing for sequence_picker module * typing for common_sub_strings module * typing for Assembly.__init__ and Assembly.__repr__ * Bump pillow from 10.3.0 to 10.4.0 Bumps [pillow](https://github.com/python-pillow/Pillow) from 10.3.0 to 10.4.0. - [Release notes](https://github.com/python-pillow/Pillow/releases) - [Changelog](https://github.com/python-pillow/Pillow/blob/main/CHANGES.rst) - [Commits](python-pillow/Pillow@10.3.0...10.4.0) --- updated-dependencies: - dependency-name: pillow dependency-type: direct:production update-type: version-update:semver-minor ... Signed-off-by: dependabot[bot] <support@github.com> * Bump autopep8 from 2.1.0 to 2.3.1 Bumps [autopep8](https://github.com/hhatto/autopep8) from 2.1.0 to 2.3.1. - [Release notes](https://github.com/hhatto/autopep8/releases) - [Commits](hhatto/autopep8@v2.1.0...v2.3.1) --- updated-dependencies: - dependency-name: autopep8 dependency-type: direct:development update-type: version-update:semver-minor ... Signed-off-by: dependabot[bot] <support@github.com> * Bump black from 24.4.2 to 24.8.0 Bumps [black](https://github.com/psf/black) from 24.4.2 to 24.8.0. - [Release notes](https://github.com/psf/black/releases) - [Changelog](https://github.com/psf/black/blob/main/CHANGES.md) - [Commits](psf/black@24.4.2...24.8.0) --- updated-dependencies: - dependency-name: black dependency-type: direct:development update-type: version-update:semver-minor ... Signed-off-by: dependabot[bot] <support@github.com> * Bump sphinx-rtd-theme from 2.0.0 to 3.0.0 Bumps [sphinx-rtd-theme](https://github.com/readthedocs/sphinx_rtd_theme) from 2.0.0 to 3.0.0. - [Changelog](https://github.com/readthedocs/sphinx_rtd_theme/blob/master/docs/changelog.rst) - [Commits](readthedocs/sphinx_rtd_theme@2.0.0...3.0.0) --- updated-dependencies: - dependency-name: sphinx-rtd-theme dependency-type: direct:development update-type: version-update:semver-major ... Signed-off-by: dependabot[bot] <support@github.com> * Bump prettytable from 3.10.0 to 3.11.0 Bumps [prettytable](https://github.com/jazzband/prettytable) from 3.10.0 to 3.11.0. - [Release notes](https://github.com/jazzband/prettytable/releases) - [Changelog](https://github.com/jazzband/prettytable/blob/main/CHANGELOG.md) - [Commits](prettytable/prettytable@3.10.0...3.11.0) --- updated-dependencies: - dependency-name: prettytable dependency-type: direct:production update-type: version-update:semver-minor ... Signed-off-by: dependabot[bot] <support@github.com> * closes #261 (#297) * tests for #281 #279, add type to pcr (#298) * update codecov action for #242 * Issue 270 (#301) * closes #270 * closes #269 by adding an example notebook + extra tests * closes #288, includes the graphics in docs notebook * added example.ipynb to tests folder * removed example.ipynb * deal with Tm = 0 * fix notebook export related to #279 * New docs (#304) * new docs * update action * update action * fix typo in action * update README + closes #305 * improve docs * document how docs work * fix autogen_docs.sh * fix crispr docstring * Fix link in README (#310) * Fix action (#311) * fix action * fix action --------- Signed-off-by: dependabot[bot] <support@github.com> Co-authored-by: BjornFJohansson <bjornjobb@gmail.com> Co-authored-by: BjornFJohansson <bjorn_johansson@bio.uminho.pt> Co-authored-by: Pei-Lun Xie <peilunx.jeff@gmail.com> Co-authored-by: Jerry Xu <jxu@hexagonbio.com> Co-authored-by: Pei-Lun Xie <31442380+JeffXiePL@users.noreply.github.com> Co-authored-by: Lucas Levassor <70581528+hiyama341@users.noreply.github.com> Co-authored-by: Kawin <krayon.py@gmail.com> Co-authored-by: dependabot[bot] <49699333+dependabot[bot]@users.noreply.github.com> Co-authored-by: Daniel García Ruano <daniel.garcia-ruano@u-bordeaux.fr>
Currently the functions do not have docstrings, and it's hard to understand how to use them.
The text was updated successfully, but these errors were encountered: